WMU48076 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ACAGTCTGAGCACATTCGGAGATTCTTTATAACACGAATTGGTAAATGCTTTTCTGTGCTTATAAGCCCGTAAGCCATTGCCAGCTTCTCACTATGCCGATTGAGTAGATATTGTTTCTCCTGCTCATTTACGTCAAGAAGAACATTGGTTACATCAGGAACATAACCAACATCCCCCG
BLAST of WMU48076 vs. TAIR10
Match: AT3G22690.1 (AT3G22690.1 Protein of unknown function DUF1685 (InterPro:IPR012881), Pentatricopeptide repeat (InterPro:IPR002885)) HSP 1 Score: 86.7 bits (213), Expect = 5.4e-18 Identity = 38/57 (66.67%), Postives = 50/57 (87.72%), Query Frame = -3
BLAST of WMU48076 vs. TAIR10
Match: AT3G13770.1 (AT3G13770.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 73.6 bits (179), Expect = 4.7e-14 Identity = 33/56 (58.93%), Postives = 44/56 (78.57%), Query Frame = -3
BLAST of WMU48076 vs. TAIR10
Match: AT1G56690.1 (AT1G56690.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 73.2 bits (178), Expect = 6.2e-14 Identity = 33/58 (56.90%), Postives = 44/58 (75.86%), Query Frame = -3
BLAST of WMU48076 vs. TAIR10
Match: AT4G33170.1 (AT4G33170.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 72.8 bits (177), Expect = 8.0e-14 Identity = 34/56 (60.71%), Postives = 40/56 (71.43%), Query Frame = -3
BLAST of WMU48076 vs. TAIR10
Match: AT2G22070.1 (AT2G22070.1 pentatricopeptide (PPR) repeat-containing protein) HSP 1 Score: 71.6 bits (174), Expect = 1.8e-13 Identity = 31/57 (54.39%), Postives = 43/57 (75.44%), Query Frame = -3
BLAST of WMU48076 vs. Swiss-Prot
Match: PP249_ARATH (Pentatricopeptide repeat-containing protein At3g22690 OS=Arabidopsis thaliana GN=PCMP-H56 PE=2 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 9.5e-17 Identity = 38/57 (66.67%), Postives = 50/57 (87.72%), Query Frame = -3
BLAST of WMU48076 vs. Swiss-Prot
Match: OGR1_ORYSJ (Pentatricopeptide repeat-containing protein OGR1, mitochondrial OS=Oryza sativa subsp. japonica GN=OGR1 PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 4.9e-13 Identity = 34/58 (58.62%), Postives = 43/58 (74.14%), Query Frame = -3
BLAST of WMU48076 vs. Swiss-Prot
Match: PP227_ARATH (Putative pentatricopeptide repeat-containing protein At3g13770, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H85 PE=3 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 8.4e-13 Identity = 33/56 (58.93%), Postives = 44/56 (78.57%), Query Frame = -3
BLAST of WMU48076 vs. Swiss-Prot
Match: PPR84_ARATH (Pentatricopeptide repeat-containing protein At1g56690, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H69 PE=2 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.1e-12 Identity = 33/58 (56.90%), Postives = 44/58 (75.86%), Query Frame = -3
BLAST of WMU48076 vs. Swiss-Prot
Match: PP347_ARATH (Pentatricopeptide repeat-containing protein At4g33170 OS=Arabidopsis thaliana GN=PCMP-H53 PE=3 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 1.4e-12 Identity = 34/56 (60.71%), Postives = 40/56 (71.43%), Query Frame = -3
BLAST of WMU48076 vs. NCBI nr
Match: gi|778678432|ref|XP_011650966.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g22690 [Cucumis sativus]) HSP 1 Score: 118.6 bits (296), Expect = 3.6e-24 Identity = 55/59 (93.22%), Postives = 59/59 (100.00%), Query Frame = -3
BLAST of WMU48076 vs. NCBI nr
Match: gi|659076373|ref|XP_008438644.1| (PREDICTED: LOW QUALITY PROTEIN: pentatricopeptide repeat-containing protein At3g22690 [Cucumis melo]) HSP 1 Score: 114.0 bits (284), Expect = 8.9e-23 Identity = 53/58 (91.38%), Postives = 57/58 (98.28%), Query Frame = -3
BLAST of WMU48076 vs. NCBI nr
Match: gi|922355202|ref|XP_003610748.2| (pentatricopeptide (PPR) repeat protein [Medicago truncatula]) HSP 1 Score: 101.3 bits (251), Expect = 6.0e-19 Identity = 46/57 (80.70%), Postives = 54/57 (94.74%), Query Frame = -3
BLAST of WMU48076 vs. NCBI nr
Match: gi|593788140|ref|XP_007157109.1| (hypothetical protein PHAVU_002G043500g [Phaseolus vulgaris]) HSP 1 Score: 101.3 bits (251), Expect = 6.0e-19 Identity = 45/57 (78.95%), Postives = 54/57 (94.74%), Query Frame = -3
BLAST of WMU48076 vs. NCBI nr
Match: gi|502159286|ref|XP_004511454.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g22690 [Cicer arietinum]) HSP 1 Score: 101.3 bits (251), Expect = 6.0e-19 Identity = 45/56 (80.36%), Postives = 53/56 (94.64%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|