WMU46651 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GTCAAGGGAAGTAGGGGGAGGAGATGGGGGTCCTTCGATAGTCAGCGACTGCCACTGTACTGCCTGAAATTTGCCTTTGCCTCATTGACCAGTCTGCCATCGTTGATAAAACTGAATATTTGATTAACCGTTGCTGCAATCTGCTCCGCTGATCCTAGCTTACATTCATCTTCTATCTTTAGATTGAAGGAGTAAAGCATGGTGGCAGTGGCTTGCGAGGTAGTAATGTTGAGATGCAAAACTGTGAGCCTAAGATCTTCCAAAGCAACAATGGACTTTCAAACAAACAAGGCCTTGCCTTTTGGGGC
BLAST of WMU46651 vs. TAIR10
Match: AT2G46810.1 (AT2G46810.1 basic helix-loop-helix (bHLH) DNA-binding superfamily protein) HSP 1 Score: 68.6 bits (166), Expect = 2.6e-12 Identity = 34/55 (61.82%), Postives = 40/55 (72.73%), Query Frame = -1
BLAST of WMU46651 vs. TAIR10
Match: AT3G61950.1 (AT3G61950.1 basic helix-loop-helix (bHLH) DNA-binding superfamily protein) HSP 1 Score: 67.4 bits (163), Expect = 5.8e-12 Identity = 34/55 (61.82%), Postives = 44/55 (80.00%), Query Frame = -1
BLAST of WMU46651 vs. TAIR10
Match: AT4G01460.1 (AT4G01460.1 basic helix-loop-helix (bHLH) DNA-binding superfamily protein) HSP 1 Score: 66.2 bits (160), Expect = 1.3e-11 Identity = 33/59 (55.93%), Postives = 45/59 (76.27%), Query Frame = -1
BLAST of WMU46651 vs. TAIR10
Match: AT3G24140.1 (AT3G24140.1 basic helix-loop-helix (bHLH) DNA-binding superfamily protein) HSP 1 Score: 61.6 bits (148), Expect = 3.2e-10 Identity = 33/59 (55.93%), Postives = 43/59 (72.88%), Query Frame = -1
BLAST of WMU46651 vs. TAIR10
Match: AT1G72210.1 (AT1G72210.1 basic helix-loop-helix (bHLH) DNA-binding superfamily protein) HSP 1 Score: 51.6 bits (122), Expect = 3.3e-07 Identity = 26/60 (43.33%), Postives = 40/60 (66.67%), Query Frame = -1
BLAST of WMU46651 vs. Swiss-Prot
Match: BH070_ARATH (Transcription factor bHLH70 OS=Arabidopsis thaliana GN=BHLH70 PE=2 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.6e-11 Identity = 34/55 (61.82%), Postives = 40/55 (72.73%), Query Frame = -1
BLAST of WMU46651 vs. Swiss-Prot
Match: BH067_ARATH (Transcription factor bHLH67 OS=Arabidopsis thaliana GN=BHLH67 PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.0e-10 Identity = 34/55 (61.82%), Postives = 44/55 (80.00%), Query Frame = -1
BLAST of WMU46651 vs. Swiss-Prot
Match: BH057_ARATH (Transcription factor bHLH57 OS=Arabidopsis thaliana GN=BHLH57 PE=2 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.3e-10 Identity = 33/59 (55.93%), Postives = 45/59 (76.27%), Query Frame = -1
BLAST of WMU46651 vs. Swiss-Prot
Match: FAMA_ARATH (Transcription factor FAMA OS=Arabidopsis thaliana GN=FAMA PE=1 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 5.7e-09 Identity = 33/59 (55.93%), Postives = 43/59 (72.88%), Query Frame = -1
BLAST of WMU46651 vs. Swiss-Prot
Match: BH096_ARATH (Transcription factor bHLH96 OS=Arabidopsis thaliana GN=BHLH96 PE=2 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 5.9e-06 Identity = 26/60 (43.33%), Postives = 40/60 (66.67%), Query Frame = -1
BLAST of WMU46651 vs. NCBI nr
Match: gi|449432974|ref|XP_004134273.1| (PREDICTED: transcription factor bHLH67 [Cucumis sativus]) HSP 1 Score: 129.8 bits (325), Expect = 2.7e-27 Identity = 69/78 (88.46%), Postives = 71/78 (91.03%), Query Frame = -1
BLAST of WMU46651 vs. NCBI nr
Match: gi|659074697|ref|XP_008437748.1| (PREDICTED: transcription factor bHLH67 isoform X1 [Cucumis melo]) HSP 1 Score: 119.8 bits (299), Expect = 2.8e-24 Identity = 67/93 (72.04%), Postives = 73/93 (78.49%), Query Frame = -1
BLAST of WMU46651 vs. NCBI nr
Match: gi|659074699|ref|XP_008437749.1| (PREDICTED: transcription factor bHLH70 isoform X2 [Cucumis melo]) HSP 1 Score: 119.8 bits (299), Expect = 2.8e-24 Identity = 67/93 (72.04%), Postives = 73/93 (78.49%), Query Frame = -1
BLAST of WMU46651 vs. NCBI nr
Match: gi|296089016|emb|CBI38719.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 87.4 bits (215), Expect = 1.5e-14 Identity = 44/59 (74.58%), Postives = 54/59 (91.53%), Query Frame = -1
BLAST of WMU46651 vs. NCBI nr
Match: gi|731420786|ref|XP_010661504.1| (PREDICTED: transcription factor bHLH70 isoform X2 [Vitis vinifera]) HSP 1 Score: 87.4 bits (215), Expect = 1.5e-14 Identity = 44/59 (74.58%), Postives = 54/59 (91.53%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|