WMU45426 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GCTTGCTAGCTCAGTATACACAAGTCCAATTCCAGGAACACGGACTAGTCCCAGACTGGGACCAAGCCCAAGAACCCATGCCATTGAGACTTTACTGTGCAGCTCGAATTCGTATCGTTTAACAGTACCATAATGCCACACATACATGATGACAAGAAAAGACTCCAGCAATCACAAGGGGAC
BLAST of WMU45426 vs. TAIR10
Match: AT1G31120.1 (AT1G31120.1 K+ uptake permease 10) HSP 1 Score: 114.4 bits (285), Expect = 2.5e-26 Identity = 53/61 (86.89%), Postives = 56/61 (91.80%), Query Frame = -1
BLAST of WMU45426 vs. TAIR10
Match: AT2G35060.2 (AT2G35060.2 K+ uptake permease 11) HSP 1 Score: 107.8 bits (268), Expect = 2.3e-24 Identity = 48/61 (78.69%), Postives = 55/61 (90.16%), Query Frame = -1
BLAST of WMU45426 vs. TAIR10
Match: AT4G19960.1 (AT4G19960.1 K+ uptake permease 9) HSP 1 Score: 101.7 bits (252), Expect = 1.7e-22 Identity = 47/61 (77.05%), Postives = 52/61 (85.25%), Query Frame = -1
BLAST of WMU45426 vs. TAIR10
Match: AT3G02050.1 (AT3G02050.1 K+ uptake transporter 3) HSP 1 Score: 94.0 bits (232), Expect = 3.5e-20 Identity = 41/61 (67.21%), Postives = 50/61 (81.97%), Query Frame = -1
BLAST of WMU45426 vs. TAIR10
Match: AT2G40540.1 (AT2G40540.1 potassium transporter 2) HSP 1 Score: 86.7 bits (213), Expect = 5.6e-18 Identity = 37/61 (60.66%), Postives = 49/61 (80.33%), Query Frame = -1
BLAST of WMU45426 vs. Swiss-Prot
Match: POT10_ARATH (Potassium transporter 10 OS=Arabidopsis thaliana GN=POT10 PE=2 SV=2) HSP 1 Score: 114.4 bits (285), Expect = 4.4e-25 Identity = 53/61 (86.89%), Postives = 56/61 (91.80%), Query Frame = -1
BLAST of WMU45426 vs. Swiss-Prot
Match: HAK18_ORYSJ (Potassium transporter 18 OS=Oryza sativa subsp. japonica GN=HAK18 PE=2 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 2.2e-24 Identity = 51/61 (83.61%), Postives = 54/61 (88.52%), Query Frame = -1
BLAST of WMU45426 vs. Swiss-Prot
Match: POT11_ARATH (Potassium transporter 11 OS=Arabidopsis thaliana GN=POT11 PE=2 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 4.1e-23 Identity = 48/61 (78.69%), Postives = 55/61 (90.16%), Query Frame = -1
BLAST of WMU45426 vs. Swiss-Prot
Match: HAK11_ORYSJ (Probable potassium transporter 11 OS=Oryza sativa subsp. japonica GN=HAK11 PE=2 SV=4) HSP 1 Score: 107.1 bits (266), Expect = 7.1e-23 Identity = 49/61 (80.33%), Postives = 53/61 (86.89%), Query Frame = -1
BLAST of WMU45426 vs. Swiss-Prot
Match: HAK12_ORYSJ (Putative potassium transporter 12 OS=Oryza sativa subsp. japonica GN=HAK12 PE=2 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 7.8e-22 Identity = 48/61 (78.69%), Postives = 52/61 (85.25%), Query Frame = -1
BLAST of WMU45426 vs. NCBI nr
Match: gi|778658295|ref|XP_011652452.1| (PREDICTED: potassium transporter 10-like [Cucumis sativus]) HSP 1 Score: 115.5 bits (288), Expect = 3.2e-23 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = -1
BLAST of WMU45426 vs. NCBI nr
Match: gi|700209374|gb|KGN64470.1| (hypothetical protein Csa_1G057060 [Cucumis sativus]) HSP 1 Score: 115.5 bits (288), Expect = 3.2e-23 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = -1
BLAST of WMU45426 vs. NCBI nr
Match: gi|659067648|ref|XP_008440560.1| (PREDICTED: potassium transporter 11-like [Cucumis melo]) HSP 1 Score: 115.5 bits (288), Expect = 3.2e-23 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = -1
BLAST of WMU45426 vs. NCBI nr
Match: gi|970010006|ref|XP_015065902.1| (PREDICTED: potassium transporter 11 [Solanum pennellii]) HSP 1 Score: 115.2 bits (287), Expect = 4.1e-23 Identity = 54/61 (88.52%), Postives = 58/61 (95.08%), Query Frame = -1
BLAST of WMU45426 vs. NCBI nr
Match: gi|641858605|gb|KDO77327.1| (hypothetical protein CISIN_1g003514mg [Citrus sinensis]) HSP 1 Score: 115.2 bits (287), Expect = 4.1e-23 Identity = 54/61 (88.52%), Postives = 58/61 (95.08%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|