WMU44000 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATAATAAGCTCTAAGAGGAACTAAATTTTCATGCTTCATCCTCCCCACCTCCTCCATTTTCTCCCTGAACTCCTTCTCCGCCGCAGTCATCTCCTTCAACCGCTTCACAGCCACCACCATCCCTGTCTCCAGTGTCGCCTTATACGCTGTCCCGAACGCCCCCTTCCCGAGGACCTCAGCCGACGCCCTCAACAAGTCCTCCAAATCAAACACATTTCCCACATTACCAAAGAACACCAATTTCTTATCCTTTTCCCCGCCCTTCCCTGATGATTTCGCTATAGTCAAATGATCTATGCTTACCCTTTCGCTACTTCCTTCCACTGTCGTCATCTTCTCTCTCGGCACCCCAACCTCACCAGCCGACCGAACCCCCTCTTTCGACTCCGATTTCCCTTTACTCTTTCTTT
BLAST of WMU44000 vs. TAIR10
Match: AT3G17840.1 (AT3G17840.1 receptor-like kinase 902) HSP 1 Score: 121.3 bits (303), Expect = 4.5e-28 Identity = 60/80 (75.00%), Postives = 67/80 (83.75%), Query Frame = -3
BLAST of WMU44000 vs. TAIR10
Match: AT1G48480.1 (AT1G48480.1 receptor-like kinase 1) HSP 1 Score: 120.9 bits (302), Expect = 5.9e-28 Identity = 61/80 (76.25%), Postives = 66/80 (82.50%), Query Frame = -3
BLAST of WMU44000 vs. TAIR10
Match: AT2G26730.1 (AT2G26730.1 Leucine-rich repeat protein kinase family protein) HSP 1 Score: 101.3 bits (251), Expect = 4.9e-22 Identity = 48/70 (68.57%), Postives = 57/70 (81.43%), Query Frame = -3
BLAST of WMU44000 vs. TAIR10
Match: AT3G08680.1 (AT3G08680.1 Leucine-rich repeat protein kinase family protein) HSP 1 Score: 100.9 bits (250), Expect = 6.3e-22 Identity = 52/81 (64.20%), Postives = 59/81 (72.84%), Query Frame = -3
BLAST of WMU44000 vs. TAIR10
Match: AT4G23740.1 (AT4G23740.1 Leucine-rich repeat protein kinase family protein) HSP 1 Score: 99.4 bits (246), Expect = 1.8e-21 Identity = 49/80 (61.25%), Postives = 58/80 (72.50%), Query Frame = -3
BLAST of WMU44000 vs. Swiss-Prot
Match: RLK90_ARATH (Probable inactive receptor kinase RLK902 OS=Arabidopsis thaliana GN=RLK902 PE=1 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 8.1e-27 Identity = 60/80 (75.00%), Postives = 67/80 (83.75%), Query Frame = -3
BLAST of WMU44000 vs. Swiss-Prot
Match: Y1848_ARATH (Probable inactive receptor kinase At1g48480 OS=Arabidopsis thaliana GN=RKL1 PE=2 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 1.1e-26 Identity = 61/80 (76.25%), Postives = 66/80 (82.50%), Query Frame = -3
BLAST of WMU44000 vs. Swiss-Prot
Match: Y2267_ARATH (Probable inactive receptor kinase At2g26730 OS=Arabidopsis thaliana GN=At2g26730 PE=1 SV=1) HSP 1 Score: 101.3 bits (251), Expect = 8.6e-21 Identity = 48/70 (68.57%), Postives = 57/70 (81.43%), Query Frame = -3
BLAST of WMU44000 vs. Swiss-Prot
Match: Y3868_ARATH (Probable inactive receptor kinase At3g08680 OS=Arabidopsis thaliana GN=At3g08680 PE=1 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 1.1e-20 Identity = 52/81 (64.20%), Postives = 59/81 (72.84%), Query Frame = -3
BLAST of WMU44000 vs. Swiss-Prot
Match: Y4374_ARATH (Probable inactive receptor kinase At4g23740 OS=Arabidopsis thaliana GN=At4g23740 PE=2 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 3.3e-20 Identity = 49/80 (61.25%), Postives = 58/80 (72.50%), Query Frame = -3
BLAST of WMU44000 vs. NCBI nr
Match: gi|449456219|ref|XP_004145847.1| (PREDICTED: probable inactive receptor kinase RLK902 [Cucumis sativus]) HSP 1 Score: 187.6 bits (475), Expect = 1.5e-44 Identity = 99/124 (79.84%), Postives = 102/124 (82.26%), Query Frame = -3
BLAST of WMU44000 vs. NCBI nr
Match: gi|659114351|ref|XP_008457025.1| (PREDICTED: probable inactive receptor kinase RLK902 [Cucumis melo]) HSP 1 Score: 185.7 bits (470), Expect = 5.6e-44 Identity = 99/124 (79.84%), Postives = 102/124 (82.26%), Query Frame = -3
BLAST of WMU44000 vs. NCBI nr
Match: gi|1009128716|ref|XP_015881385.1| (PREDICTED: probable inactive receptor kinase RLK902 isoform X2 [Ziziphus jujuba]) HSP 1 Score: 135.2 bits (339), Expect = 8.6e-29 Identity = 76/119 (63.87%), Postives = 82/119 (68.91%), Query Frame = -3
BLAST of WMU44000 vs. NCBI nr
Match: gi|1009128714|ref|XP_015881384.1| (PREDICTED: probable inactive receptor kinase RLK902 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 135.2 bits (339), Expect = 8.6e-29 Identity = 76/119 (63.87%), Postives = 82/119 (68.91%), Query Frame = -3
BLAST of WMU44000 vs. NCBI nr
Match: gi|1021040687|gb|KZM98468.1| (hypothetical protein DCAR_014170 [Daucus carota subsp. sativus]) HSP 1 Score: 131.7 bits (330), Expect = 9.5e-28 Identity = 73/123 (59.35%), Postives = 88/123 (71.54%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|