WMU43809 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAAAGGTTCAGCTAAAATCTCCACCTGAGAAGTTCTATGGCTTCTTCAGGAACCATATGGGAGATTTGGTCAATATGTATCCTGAGCACTTCCAAAGCTTCCAGTTTCTTGAAGGAGATAGCTTCTCTACTGGCAGTGTTATGCATTGGCAATACCACCTTGGGAGTCCAGCAGCAGCAAAGATAAAGATGAGACTTGTGGATGATGTGAAGAGGT
BLAST of WMU43809 vs. NCBI nr
Match: gi|659114461|ref|XP_008457062.1| (PREDICTED: MLP-like protein 423 [Cucumis melo]) HSP 1 Score: 142.1 bits (357), Expect = 3.7e-31 Identity = 64/71 (90.14%), Postives = 71/71 (100.00%), Query Frame = 3
BLAST of WMU43809 vs. NCBI nr
Match: gi|449464144|ref|XP_004149789.1| (PREDICTED: MLP-like protein 34 [Cucumis sativus]) HSP 1 Score: 138.7 bits (348), Expect = 4.1e-30 Identity = 62/71 (87.32%), Postives = 70/71 (98.59%), Query Frame = 3
BLAST of WMU43809 vs. NCBI nr
Match: gi|659114589|ref|XP_008457130.1| (PREDICTED: MLP-like protein 31 [Cucumis melo]) HSP 1 Score: 91.3 bits (225), Expect = 7.4e-16 Identity = 43/73 (58.90%), Postives = 55/73 (75.34%), Query Frame = 3
BLAST of WMU43809 vs. NCBI nr
Match: gi|778688602|ref|XP_011652791.1| (PREDICTED: uncharacterized protein LOC105435098 [Cucumis sativus]) HSP 1 Score: 88.2 bits (217), Expect = 6.3e-15 Identity = 43/73 (58.90%), Postives = 55/73 (75.34%), Query Frame = 3
BLAST of WMU43809 vs. NCBI nr
Match: gi|477504344|dbj|BAN14689.1| (major latex-like protein [Cucurbita pepo subsp. pepo]) HSP 1 Score: 85.1 bits (209), Expect = 5.3e-14 Identity = 40/72 (55.56%), Postives = 54/72 (75.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|