WMU43489 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ACCTAGGCCCTGCCGTTGACAGAGGAATGGGTGTTGTTCCGCCTGTGTGGGACTTGATCACCGAGGTGGAGGAGCATGCCTTGTAGCTTTCTTCATTCACCTCGTCCACTGAGTGACTCCCACCATAATTGAACACTAATGTGTCGCCAACCCTAAAAGTCTGCCCTGCAGCCCAGGTGTCGTAGTTCACCCCCTGGTTCCACCCAGAGTTGCCGCCAACGATGATATCTGCTCCATAAACCGCCCGCACCGCTACCAAAACAACCAATACAGCAGCCGCTTTCATCGCCATTTCTGCAACACACAAATACAATTATGATAGAAAATTACTCACAAACTTTTTCTTTTTGGAAACAGATTATCAGTTGTTACCTTAGCACAGAG
BLAST of WMU43489 vs. TAIR10
Match: AT1G22480.1 (AT1G22480.1 Cupredoxin superfamily protein) HSP 1 Score: 79.3 bits (194), Expect = 1.8e-15 Identity = 35/67 (52.24%), Postives = 44/67 (65.67%), Query Frame = -3
BLAST of WMU43489 vs. TAIR10
Match: AT1G72230.1 (AT1G72230.1 Cupredoxin superfamily protein) HSP 1 Score: 78.2 bits (191), Expect = 4.1e-15 Identity = 34/66 (51.52%), Postives = 44/66 (66.67%), Query Frame = -3
BLAST of WMU43489 vs. TAIR10
Match: AT2G44790.1 (AT2G44790.1 uclacyanin 2) HSP 1 Score: 74.3 bits (181), Expect = 5.9e-14 Identity = 32/65 (49.23%), Postives = 41/65 (63.08%), Query Frame = -3
BLAST of WMU43489 vs. TAIR10
Match: AT3G60270.1 (AT3G60270.1 Cupredoxin superfamily protein) HSP 1 Score: 73.2 bits (178), Expect = 1.3e-13 Identity = 34/71 (47.89%), Postives = 41/71 (57.75%), Query Frame = -3
BLAST of WMU43489 vs. TAIR10
Match: AT3G60280.1 (AT3G60280.1 uclacyanin 3) HSP 1 Score: 71.6 bits (174), Expect = 3.9e-13 Identity = 34/77 (44.16%), Postives = 43/77 (55.84%), Query Frame = -3
BLAST of WMU43489 vs. Swiss-Prot
Match: BCP_PEA (Blue copper protein OS=Pisum sativum PE=2 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.7e-15 Identity = 40/72 (55.56%), Postives = 49/72 (68.06%), Query Frame = -3
BLAST of WMU43489 vs. Swiss-Prot
Match: BCB2_ARATH (Uclacyanin-2 OS=Arabidopsis thaliana GN=At2g44790 PE=1 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 1.1e-12 Identity = 32/65 (49.23%), Postives = 41/65 (63.08%), Query Frame = -3
BLAST of WMU43489 vs. Swiss-Prot
Match: BCB3_ARATH (Uclacyanin-3 OS=Arabidopsis thaliana GN=UCC3 PE=2 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 6.8e-12 Identity = 34/77 (44.16%), Postives = 43/77 (55.84%), Query Frame = -3
BLAST of WMU43489 vs. Swiss-Prot
Match: MAVI_CUCPE (Mavicyanin OS=Cucurbita pepo PE=1 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.1e-09 Identity = 32/74 (43.24%), Postives = 44/74 (59.46%), Query Frame = -3
BLAST of WMU43489 vs. Swiss-Prot
Match: STEL_TOXVR (Stellacyanin OS=Toxicodendron vernicifluum PE=1 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 4.6e-08 Identity = 31/79 (39.24%), Postives = 46/79 (58.23%), Query Frame = -3
BLAST of WMU43489 vs. NCBI nr
Match: gi|449431954|ref|XP_004133765.1| (PREDICTED: uclacyanin-2 [Cucumis sativus]) HSP 1 Score: 139.0 bits (349), Expect = 5.6e-30 Identity = 66/79 (83.54%), Postives = 69/79 (87.34%), Query Frame = -3
BLAST of WMU43489 vs. NCBI nr
Match: gi|659074745|ref|XP_008437773.1| (PREDICTED: basic blue protein [Cucumis melo]) HSP 1 Score: 137.9 bits (346), Expect = 1.2e-29 Identity = 66/79 (83.54%), Postives = 69/79 (87.34%), Query Frame = -3
BLAST of WMU43489 vs. NCBI nr
Match: gi|702321396|ref|XP_010052796.1| (PREDICTED: mavicyanin-like [Eucalyptus grandis]) HSP 1 Score: 99.4 bits (246), Expect = 4.9e-18 Identity = 46/78 (58.97%), Postives = 59/78 (75.64%), Query Frame = -3
BLAST of WMU43489 vs. NCBI nr
Match: gi|1021030175|gb|KZM87960.1| (hypothetical protein DCAR_025061 [Daucus carota subsp. sativus]) HSP 1 Score: 99.0 bits (245), Expect = 6.4e-18 Identity = 45/78 (57.69%), Postives = 57/78 (73.08%), Query Frame = -3
BLAST of WMU43489 vs. NCBI nr
Match: gi|593264564|ref|XP_007134460.1| (hypothetical protein PHAVU_010G049200g [Phaseolus vulgaris]) HSP 1 Score: 97.8 bits (242), Expect = 1.4e-17 Identity = 43/79 (54.43%), Postives = 58/79 (73.42%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|