WMU42608 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TCCTATTTACGGTCAAGAAGAATTGGAAACAGTGATACCACAAATTGGTGGCTTAGTAAAGATTGTAAATGGGGCGTATCGAGGATCAAATGCTAGGTTGTTGGGCGTTGATACTGATAAGTTTTGTGCTAAAGTGCAAATAGAGAGGGGTGTGTATGATGGCAGGGTACTTAAGGCTGTTGAATATGAAGATATTTGTAAACTTGCATCATAACTTTCATATATAAGAGAAAACTCCCCTATTTGTAGTTTTGTTCTCAATATTTTTTTGTTCTAGTATGAGATTTGATGTCTTCC
BLAST of WMU42608 vs. TAIR10
Match: AT1G55460.1 (AT1G55460.1 DNA/RNA-binding protein Kin17, conserved region) HSP 1 Score: 123.6 bits (309), Expect = 6.6e-29 Identity = 57/65 (87.69%), Postives = 63/65 (96.92%), Query Frame = 2
BLAST of WMU42608 vs. TAIR10
Match: AT5G51795.1 (AT5G51795.1 DNA/RNA-binding protein Kin17, conserved region) HSP 1 Score: 115.5 bits (288), Expect = 1.8e-26 Identity = 53/65 (81.54%), Postives = 60/65 (92.31%), Query Frame = 2
BLAST of WMU42608 vs. Swiss-Prot
Match: KIN17_MOUSE (DNA/RNA-binding protein KIN17 OS=Mus musculus GN=Kin PE=1 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 1.0e-07 Identity = 29/65 (44.62%), Postives = 38/65 (58.46%), Query Frame = 2
BLAST of WMU42608 vs. Swiss-Prot
Match: KIN17_HUMAN (DNA/RNA-binding protein KIN17 OS=Homo sapiens GN=KIN PE=1 SV=2) HSP 1 Score: 57.0 bits (136), Expect = 1.3e-07 Identity = 28/65 (43.08%), Postives = 38/65 (58.46%), Query Frame = 2
BLAST of WMU42608 vs. NCBI nr
Match: gi|449455862|ref|XP_004145669.1| (PREDICTED: DNA/RNA-binding protein KIN17 [Cucumis sativus]) HSP 1 Score: 134.4 bits (337), Expect = 1.1e-28 Identity = 64/66 (96.97%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of WMU42608 vs. NCBI nr
Match: gi|659098345|ref|XP_008450093.1| (PREDICTED: DNA/RNA-binding protein KIN17 [Cucumis melo]) HSP 1 Score: 132.1 bits (331), Expect = 5.3e-28 Identity = 63/66 (95.45%), Postives = 65/66 (98.48%), Query Frame = 2
BLAST of WMU42608 vs. NCBI nr
Match: gi|224098413|ref|XP_002311165.1| (Kin17 DNA-binding family protein [Populus trichocarpa]) HSP 1 Score: 131.7 bits (330), Expect = 6.9e-28 Identity = 62/65 (95.38%), Postives = 65/65 (100.00%), Query Frame = 2
BLAST of WMU42608 vs. NCBI nr
Match: gi|743844394|ref|XP_011027191.1| (PREDICTED: DNA/RNA-binding protein KIN17 [Populus euphratica]) HSP 1 Score: 131.7 bits (330), Expect = 6.9e-28 Identity = 62/65 (95.38%), Postives = 65/65 (100.00%), Query Frame = 2
BLAST of WMU42608 vs. NCBI nr
Match: gi|224112785|ref|XP_002316291.1| (Kin17 DNA-binding family protein [Populus trichocarpa]) HSP 1 Score: 131.7 bits (330), Expect = 6.9e-28 Identity = 62/65 (95.38%), Postives = 65/65 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|