WMU42409 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGCGTCGACGGCGAACCGAGTGAAATGGAAGGGTTATCATGTGATAACCAGTGCGGCGGAGGCTTCAAAGTTCACCGTCGGGAATTTCATCGCCGGTGGATCTTGGTTGCCGAGTACCGGCGTGCCTTTTCACCTCCGGCCTCTGATTTGGTTTCGTTCTTCTCTGCTTTACTATATTTTGTATGTATTCTTAAATATTAATAATCGTTATTTGTTAAATTAAACTTAAAATCAAGTTTCTCATTAAGAAATTAGATTTAATTATAATT
BLAST of WMU42409 vs. TAIR10
Match: AT3G47400.1 (AT3G47400.1 Plant invertase/pectin methylesterase inhibitor superfamily) HSP 1 Score: 70.5 bits (171), Expect = 6.0e-13 Identity = 31/43 (72.09%), Postives = 35/43 (81.40%), Query Frame = 2
BLAST of WMU42409 vs. TAIR10
Match: AT3G14310.1 (AT3G14310.1 pectin methylesterase 3) HSP 1 Score: 70.1 bits (170), Expect = 7.9e-13 Identity = 31/45 (68.89%), Postives = 33/45 (73.33%), Query Frame = 2
BLAST of WMU42409 vs. TAIR10
Match: AT1G53830.1 (AT1G53830.1 pectin methylesterase 2) HSP 1 Score: 68.9 bits (167), Expect = 1.7e-12 Identity = 32/45 (71.11%), Postives = 30/45 (66.67%), Query Frame = 2
BLAST of WMU42409 vs. TAIR10
Match: AT5G53370.1 (AT5G53370.1 pectin methylesterase PCR fragment F) HSP 1 Score: 67.0 bits (162), Expect = 6.6e-12 Identity = 30/38 (78.95%), Postives = 29/38 (76.32%), Query Frame = 2
BLAST of WMU42409 vs. TAIR10
Match: AT5G51490.1 (AT5G51490.1 Plant invertase/pectin methylesterase inhibitor superfamily) HSP 1 Score: 63.2 bits (152), Expect = 9.6e-11 Identity = 27/43 (62.79%), Postives = 32/43 (74.42%), Query Frame = 2
BLAST of WMU42409 vs. Swiss-Prot
Match: PME2_CITSI (Pectinesterase 2 OS=Citrus sinensis GN=PECS-2.1 PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.9e-13 Identity = 32/43 (74.42%), Postives = 37/43 (86.05%), Query Frame = 2
BLAST of WMU42409 vs. Swiss-Prot
Match: PME33_ARATH (Probable pectinesterase/pectinesterase inhibitor 33 OS=Arabidopsis thaliana GN=PME33 PE=2 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.1e-11 Identity = 31/43 (72.09%), Postives = 35/43 (81.40%), Query Frame = 2
BLAST of WMU42409 vs. Swiss-Prot
Match: PME3_ARATH (Pectinesterase/pectinesterase inhibitor 3 OS=Arabidopsis thaliana GN=PME3 PE=2 SV=2) HSP 1 Score: 70.1 bits (170), Expect = 1.4e-11 Identity = 31/45 (68.89%), Postives = 33/45 (73.33%), Query Frame = 2
BLAST of WMU42409 vs. Swiss-Prot
Match: PME2_ARATH (Pectinesterase 2 OS=Arabidopsis thaliana GN=PME2 PE=2 SV=2) HSP 1 Score: 68.9 bits (167), Expect = 3.1e-11 Identity = 32/45 (71.11%), Postives = 30/45 (66.67%), Query Frame = 2
BLAST of WMU42409 vs. Swiss-Prot
Match: PME61_ARATH (Probable pectinesterase/pectinesterase inhibitor 61 OS=Arabidopsis thaliana GN=PME61 PE=2 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-10 Identity = 30/38 (78.95%), Postives = 29/38 (76.32%), Query Frame = 2
BLAST of WMU42409 vs. NCBI nr
Match: gi|449432283|ref|XP_004133929.1| (PREDICTED: pectinesterase 2 [Cucumis sativus]) HSP 1 Score: 89.0 bits (219), Expect = 4.6e-15 Identity = 41/43 (95.35%), Postives = 42/43 (97.67%), Query Frame = 2
BLAST of WMU42409 vs. NCBI nr
Match: gi|659075527|ref|XP_008438193.1| (PREDICTED: pectinesterase 2 [Cucumis melo]) HSP 1 Score: 87.0 bits (214), Expect = 1.8e-14 Identity = 41/43 (95.35%), Postives = 41/43 (95.35%), Query Frame = 2
BLAST of WMU42409 vs. NCBI nr
Match: gi|702340966|ref|XP_010056340.1| (PREDICTED: pectinesterase 2-like [Eucalyptus grandis]) HSP 1 Score: 82.4 bits (202), Expect = 4.3e-13 Identity = 37/43 (86.05%), Postives = 40/43 (93.02%), Query Frame = 2
BLAST of WMU42409 vs. NCBI nr
Match: gi|1012335149|gb|KYP46488.1| (Pectinesterase 2 [Cajanus cajan]) HSP 1 Score: 82.0 bits (201), Expect = 5.7e-13 Identity = 37/43 (86.05%), Postives = 40/43 (93.02%), Query Frame = 2
BLAST of WMU42409 vs. NCBI nr
Match: gi|1021486209|ref|XP_016186105.1| (PREDICTED: pectinesterase 2-like [Arachis ipaensis]) HSP 1 Score: 80.9 bits (198), Expect = 1.3e-12 Identity = 37/43 (86.05%), Postives = 39/43 (90.70%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|