WMU42256 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGAAGTTTGGCAACAATGGCGGAACCATTTGGCGGCGTCAACTACGATCTTGAGCAGACCTTGAAGCCCTTCTTCCAAAGAGCTTCTGAAGCTGAGTTTGTTTTGCAGACTAAAGTTGAAATCCATCTGAATAATGCTGCACGAAAAGAATTATGCTTTTAGTTTATTCAGGATCGTTTTGTCAAGATTAGAAGATGCACTCTTGAGTAAGAAAGACGTCCATAACAAAGATCATCTGAAAACAATAAGCGAACTCCAGTCGAAGCTAGACAGCACAAACGAAGCGCTAATCGAAGAACGGAAAAAGGCTGAGATGGTTGCTGCAGAAAATGCTAAGCTTCAGTATCGCATAATCCATCTTGTGAGGACAGCTAGGGAAACCGATTAAAAGTTGGAGAAAGAATGTTTCTTTT
BLAST of WMU42256 vs. TAIR10
Match: AT3G57320.1 (AT3G57320.1 unknown protein) HSP 1 Score: 56.6 bits (135), Expect = 1.4e-08 Identity = 31/75 (41.33%), Postives = 47/75 (62.67%), Query Frame = 2
BLAST of WMU42256 vs. NCBI nr
Match: gi|659129281|ref|XP_008464609.1| (PREDICTED: uncharacterized protein LOC103502450 isoform X2 [Cucumis melo]) HSP 1 Score: 112.1 bits (279), Expect = 7.9e-22 Identity = 60/68 (88.24%), Postives = 63/68 (92.65%), Query Frame = 2
BLAST of WMU42256 vs. NCBI nr
Match: gi|1009159888|ref|XP_015898059.1| (PREDICTED: uncharacterized protein LOC107431605 [Ziziphus jujuba]) HSP 1 Score: 87.4 bits (215), Expect = 2.1e-14 Identity = 47/73 (64.38%), Postives = 56/73 (76.71%), Query Frame = 2
BLAST of WMU42256 vs. NCBI nr
Match: gi|351724963|ref|NP_001236820.1| (uncharacterized protein LOC100527237 [Glycine max]) HSP 1 Score: 85.5 bits (210), Expect = 7.9e-14 Identity = 46/74 (62.16%), Postives = 58/74 (78.38%), Query Frame = 2
BLAST of WMU42256 vs. NCBI nr
Match: gi|1021480783|ref|XP_016183537.1| (PREDICTED: uncharacterized protein LOC107625423 [Arachis ipaensis]) HSP 1 Score: 83.2 bits (204), Expect = 3.9e-13 Identity = 42/74 (56.76%), Postives = 59/74 (79.73%), Query Frame = 2
BLAST of WMU42256 vs. NCBI nr
Match: gi|1012019867|ref|XP_015949674.1| (PREDICTED: uncharacterized protein LOC107474568 [Arachis duranensis]) HSP 1 Score: 82.8 bits (203), Expect = 5.1e-13 Identity = 42/74 (56.76%), Postives = 59/74 (79.73%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|