WMU41555 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GTTTGGCTGCAAAAACAATGGTATGGGGGGTTTGGTTGGGGATGATGATATTCGGAGCTAGTGAAGTAAGCAGAAACGTAGATCTGGGCGATGAGACAACAACCATGCTATGCAAAATTTGTTGTTCGAGCATCTGATGCATCAATTACAAAGGAAATCGAAGTTGATCCTCAAGGTTGGTTAGATGACATAACTGATGGAGGCGTTGAGTACATGCCTGAAGAGGAAGTCAAGGTAGCTGCTGCAGAAAGGCTGAAGATATCAATGGAACGGATAGCTTTGCTCAAGGCAGCCCAACCTCCACCAAAGACCCCAAAATCAGACGATGACGACGAAGAAGAAGAAGAAGAAGCCAAAGACATCGATAG
BLAST of WMU41555 vs. TAIR10
Match: AT3G01780.1 (AT3G01780.1 ARM repeat superfamily protein) HSP 1 Score: 106.3 bits (264), Expect = 1.4e-23 Identity = 55/68 (80.88%), Postives = 58/68 (85.29%), Query Frame = 1
HSP 2 Score: 57.4 bits (137), Expect = 7.2e-09 Identity = 30/38 (78.95%), Postives = 32/38 (84.21%), Query Frame = 3
BLAST of WMU41555 vs. Swiss-Prot
Match: TPLAT_ARATH (Protein TPLATE OS=Arabidopsis thaliana GN=TPLATE PE=1 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 2.4e-22 Identity = 55/68 (80.88%), Postives = 58/68 (85.29%), Query Frame = 1
HSP 2 Score: 57.4 bits (137), Expect = 1.3e-07 Identity = 30/38 (78.95%), Postives = 32/38 (84.21%), Query Frame = 3
BLAST of WMU41555 vs. NCBI nr
Match: gi|778679265|ref|XP_004147656.2| (PREDICTED: protein TPLATE [Cucumis sativus]) HSP 1 Score: 136.3 bits (342), Expect = 3.5e-29 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of WMU41555 vs. NCBI nr
Match: gi|659077158|ref|XP_008439063.1| (PREDICTED: protein TPLATE [Cucumis melo]) HSP 1 Score: 134.8 bits (338), Expect = 1.0e-28 Identity = 68/69 (98.55%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of WMU41555 vs. NCBI nr
Match: gi|702464866|ref|XP_010029027.1| (PREDICTED: protein TPLATE [Eucalyptus grandis]) HSP 1 Score: 123.2 bits (308), Expect = 3.0e-25 Identity = 62/69 (89.86%), Postives = 66/69 (95.65%), Query Frame = 1
BLAST of WMU41555 vs. NCBI nr
Match: gi|802539411|ref|XP_012070910.1| (PREDICTED: protein TPLATE [Jatropha curcas]) HSP 1 Score: 122.5 bits (306), Expect = 5.2e-25 Identity = 61/69 (88.41%), Postives = 65/69 (94.20%), Query Frame = 1
BLAST of WMU41555 vs. NCBI nr
Match: gi|296090248|emb|CBI40067.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 121.3 bits (303), Expect = 1.2e-24 Identity = 61/69 (88.41%), Postives = 64/69 (92.75%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|