WMU40307 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AAAAAAACGGTGACGGTGGCCGGAAACTTCCAAGTTCCATTCAAGGAAAGTGTGGCAATGGCAATGGAATCTAAGGATCCATATTTGGACTTCAAGAAGTCAATGGAAGAGATGGTAGAAGCTCATGGATTGAAGGATTGGAAAGGAATGGAATTGCTTTTGAGTTGGTATTTTAAAAGGCTAATGGAAAGCCAAATCATGAGTTTATTATTGGTGCCTTTGTGGATTTATTGGTTGATCTTGCTTTTGCTTCTTCTTTCACTAATAATTCTCTTCTCCATCTTCTTCTTCAACTACTTCTTCTCTTCTGTGTTCTTCTTGTTCTTCTACCTTTCCTAATTCTTCTTCGTGTTCTTCCTGTTCTTCTTTTAGAG
BLAST of WMU40307 vs. TAIR10
Match: AT5G04820.1 (AT5G04820.1 ovate family protein 13) HSP 1 Score: 67.4 bits (163), Expect = 7.1e-12 Identity = 33/62 (53.23%), Postives = 44/62 (70.97%), Query Frame = 1
BLAST of WMU40307 vs. TAIR10
Match: AT2G36050.1 (AT2G36050.1 ovate family protein 15) HSP 1 Score: 52.0 bits (123), Expect = 3.1e-07 Identity = 25/40 (62.50%), Postives = 28/40 (70.00%), Query Frame = 1
BLAST of WMU40307 vs. TAIR10
Match: AT3G52540.1 (AT3G52540.1 ovate family protein 18) HSP 1 Score: 50.4 bits (119), Expect = 9.0e-07 Identity = 23/41 (56.10%), Postives = 27/41 (65.85%), Query Frame = 1
HSP 2 Score: 30.4 bits (67), Expect = 9.6e-01 Identity = 14/29 (48.28%), Postives = 17/29 (58.62%), Query Frame = 3
BLAST of WMU40307 vs. Swiss-Prot
Match: OPF13_ARATH (Transcription repressor OFP13 OS=Arabidopsis thaliana GN=OFP13 PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.3e-10 Identity = 33/62 (53.23%), Postives = 44/62 (70.97%), Query Frame = 1
BLAST of WMU40307 vs. Swiss-Prot
Match: OPF15_ARATH (Transcription repressor OFP15 OS=Arabidopsis thaliana GN=OFP15 PE=1 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 5.5e-06 Identity = 25/40 (62.50%), Postives = 28/40 (70.00%), Query Frame = 1
BLAST of WMU40307 vs. NCBI nr
Match: gi|778717596|ref|XP_011657721.1| (PREDICTED: transcription repressor OFP15-like [Cucumis sativus]) HSP 1 Score: 101.7 bits (252), Expect = 9.6e-19 Identity = 48/54 (88.89%), Postives = 50/54 (92.59%), Query Frame = 1
BLAST of WMU40307 vs. NCBI nr
Match: gi|659125408|ref|XP_008462672.1| (PREDICTED: putative uncharacterized protein DDB_G0277255 [Cucumis melo]) HSP 1 Score: 101.7 bits (252), Expect = 9.6e-19 Identity = 48/53 (90.57%), Postives = 49/53 (92.45%), Query Frame = 1
BLAST of WMU40307 vs. NCBI nr
Match: gi|1009161338|ref|XP_015898843.1| (PREDICTED: transcription repressor OFP15 [Ziziphus jujuba]) HSP 1 Score: 83.6 bits (205), Expect = 2.7e-13 Identity = 35/48 (72.92%), Postives = 44/48 (91.67%), Query Frame = 1
BLAST of WMU40307 vs. NCBI nr
Match: gi|703131083|ref|XP_010104796.1| (hypothetical protein L484_018851 [Morus notabilis]) HSP 1 Score: 81.3 bits (199), Expect = 1.3e-12 Identity = 37/48 (77.08%), Postives = 44/48 (91.67%), Query Frame = 1
BLAST of WMU40307 vs. NCBI nr
Match: gi|764607983|ref|XP_011467256.1| (PREDICTED: transcription repressor OFP13 [Fragaria vesca subsp. vesca]) HSP 1 Score: 81.3 bits (199), Expect = 1.3e-12 Identity = 35/52 (67.31%), Postives = 45/52 (86.54%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|