WMU36857 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GAGAAAGTGGGGTGCAGGAGTCAGTTCTAAGCAATGGGATGCGAACGGTGCTTTCAATGGGGTTCGGTTATCTACAGGTGATTGAAGCTTATAGCATATTTGGAGACGATGTGGATTCAATGGTTTTGTTATTTGTTGGAAACTGGGGATAGCAGCAGACGCAAAGGCAAAGCCACTGAATGATCGATGAAAAGCAGCAGCCGGCAACAGCAGCTAATTACCTTAGGACACTGATGGAAGAAGGTTGGTCTCTCTCTCTCGCCCTCTATCTGTATTCCAACATCATTTGTTTCACGTAGAAAGTGATGATGTCAAAGGAGAGGGCATGTAGGGGAACAAATTTGAATCCTGCTCTGGTATGATATCATAATAAAGCAAACTCGACCTTTTAATCTCTACTCTATTACAAGCTCTCTATTGTTTCCACTTCCATACCAGAAAACGTACGGTCCTTCGTACGTATTTGGTATTATTTTCTTGCAAGAAAATACAAGAAAATCGTCAAAAGAACATTTATCTCGTTTAC
BLAST of WMU36857 vs. TAIR10
Match: AT2G27350.5 (AT2G27350.5 OTU-like cysteine protease family protein) HSP 1 Score: 54.7 bits (130), Expect = 6.7e-08 Identity = 26/41 (63.41%), Postives = 31/41 (75.61%), Query Frame = 3
BLAST of WMU36857 vs. TrEMBL
Match: A0A0A0LVH3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G166830 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 8.5e-12 Identity = 39/41 (95.12%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of WMU36857 vs. TrEMBL
Match: A0A0A0LVH3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G166830 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 2.0e+00 Identity = 18/18 (100.00%), Postives = 18/18 (100.00%), Query Frame = 1
HSP 2 Score: 66.6 bits (161), Expect = 3.4e-08 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = 3
BLAST of WMU36857 vs. TrEMBL
Match: A0A0K9QLD9_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_166130 PE=4 SV=1) HSP 1 Score: 35.8 bits (81), Expect = 6.4e+01 Identity = 16/18 (88.89%), Postives = 16/18 (88.89%), Query Frame = 1
HSP 2 Score: 65.5 bits (158), Expect = 7.5e-08 Identity = 32/41 (78.05%), Postives = 36/41 (87.80%), Query Frame = 3
BLAST of WMU36857 vs. TrEMBL
Match: B9HQ41_POPTR (OTU-like cysteine protease family protein OS=Populus trichocarpa GN=POPTR_0009s16170g PE=4 SV=1) HSP 1 Score: 38.5 bits (88), Expect = 9.8e+00 Identity = 17/18 (94.44%), Postives = 17/18 (94.44%), Query Frame = 1
HSP 2 Score: 65.5 bits (158), Expect = 7.5e-08 Identity = 32/41 (78.05%), Postives = 36/41 (87.80%), Query Frame = 3
BLAST of WMU36857 vs. TrEMBL
Match: A0A067KUM9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_04182 PE=4 SV=1) HSP 1 Score: 33.5 bits (75), Expect = 3.2e+02 Identity = 17/19 (89.47%), Postives = 17/19 (89.47%), Query Frame = 1
HSP 2 Score: 65.5 bits (158), Expect = 7.5e-08 Identity = 32/41 (78.05%), Postives = 36/41 (87.80%), Query Frame = 3
BLAST of WMU36857 vs. NCBI nr
Match: gi|659071632|ref|XP_008461136.1| (PREDICTED: OTU domain-containing protein 5-B [Cucumis melo]) HSP 1 Score: 80.5 bits (197), Expect = 3.2e-12 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of WMU36857 vs. NCBI nr
Match: gi|778659493|ref|XP_011654529.1| (PREDICTED: OTU domain-containing protein 5-B [Cucumis sativus]) HSP 1 Score: 79.0 bits (193), Expect = 9.4e-12 Identity = 39/41 (95.12%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of WMU36857 vs. NCBI nr
Match: gi|1009113347|ref|XP_015872988.1| (PREDICTED: OTU domain-containing protein 5 isoform X2 [Ziziphus jujuba]) HSP 1 Score: 68.6 bits (166), Expect = 1.3e-08 Identity = 33/41 (80.49%), Postives = 37/41 (90.24%), Query Frame = 3
BLAST of WMU36857 vs. NCBI nr
Match: gi|1009113341|ref|XP_015872967.1| (PREDICTED: OTU domain-containing protein 5 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 68.6 bits (166), Expect = 1.3e-08 Identity = 33/41 (80.49%), Postives = 37/41 (90.24%), Query Frame = 3
BLAST of WMU36857 vs. NCBI nr
Match: gi|902171904|gb|KNA08059.1| (hypothetical protein SOVF_166130 [Spinacia oleracea]) HSP 1 Score: 67.0 bits (162), Expect = 3.7e-08 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|