WMU36798 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AAAAAGTGACGCAACAAGGTGAACATGAATCACTTAACCGAGACATACTGGCTATTTTGGGAGAAAAATGGGAGTTTGACCCGATCAATCGACTTGAGACAAATCCATTCCCTGACAACAATGGCTCTGTTCATATTTGGCAAGGCCGTGAAGACCGTGTCGTTGCTCTTGAGTTTAATCGTTTTATAGCAGAGAAACTTCCTTGGATTCAATATCATGAAGTTCCTGACGGTGGGCATCTAATAATTCATGATGCTGAAAAAATTTGAAGCTATAGTAAGGGCACTTTTGGCCAGGTAAGTTCATCTTTGTTGGGTGATGCTGCCATCATGTAATACACGATAAATTTCCATTCAGTATTGTATTGTATTATATCCACGATAAAATTCCATTCAGTAGTGGCAACAAACTGATCCTCCTGGAGCTGGCTGTATGCTGAATGGCAATTCATTTTGCTGCTGCTGATTGTGTTATGTAGCTGGACTCGGCTTAGAACAGCTTTGTTAAGGTGATAGATCATATCCAGAATCAAATCTATAACTTTTATCCATGTTGTCTAGCTACAATTGACTTCTATTTCAATTAATTGAACTTAAACTTCTCTCCCCTAG
BLAST of WMU36798 vs. TAIR10
Match: AT5G22460.1 (AT5G22460.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 102.4 bits (254), Expect = 3.3e-22 Identity = 50/87 (57.47%), Postives = 61/87 (70.11%), Query Frame = 3
BLAST of WMU36798 vs. TAIR10
Match: AT3G54240.1 (AT3G54240.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 97.8 bits (242), Expect = 8.0e-21 Identity = 44/80 (55.00%), Postives = 58/80 (72.50%), Query Frame = 3
BLAST of WMU36798 vs. TAIR10
Match: AT2G36290.1 (AT2G36290.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 94.0 bits (232), Expect = 1.2e-19 Identity = 44/80 (55.00%), Postives = 57/80 (71.25%), Query Frame = 3
BLAST of WMU36798 vs. TAIR10
Match: AT1G74300.1 (AT1G74300.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 94.0 bits (232), Expect = 1.2e-19 Identity = 45/79 (56.96%), Postives = 55/79 (69.62%), Query Frame = 3
BLAST of WMU36798 vs. TAIR10
Match: AT1G74290.1 (AT1G74290.1 alpha/beta-Hydrolases superfamily protein) HSP 1 Score: 94.0 bits (232), Expect = 1.2e-19 Identity = 45/104 (43.27%), Postives = 63/104 (60.58%), Query Frame = 3
BLAST of WMU36798 vs. TrEMBL
Match: A0A0A0LSN0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G161090 PE=4 SV=1) HSP 1 Score: 163.3 bits (412), Expect = 3.1e-37 Identity = 77/87 (88.51%), Postives = 79/87 (90.80%), Query Frame = 3
BLAST of WMU36798 vs. TrEMBL
Match: A0A0A0KSU1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G650285 PE=4 SV=1) HSP 1 Score: 123.2 bits (308), Expect = 3.5e-25 Identity = 55/86 (63.95%), Postives = 69/86 (80.23%), Query Frame = 3
BLAST of WMU36798 vs. TrEMBL
Match: A0A061GW93_THECC (Alpha/beta-Hydrolases superfamily protein isoform 2 OS=Theobroma cacao GN=TCM_041438 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 1.7e-24 Identity = 53/86 (61.63%), Postives = 69/86 (80.23%), Query Frame = 3
BLAST of WMU36798 vs. TrEMBL
Match: A0A061GVE0_THECC (Alpha/beta-Hydrolases superfamily protein isoform 1 OS=Theobroma cacao GN=TCM_041438 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 1.7e-24 Identity = 53/86 (61.63%), Postives = 69/86 (80.23%), Query Frame = 3
BLAST of WMU36798 vs. TrEMBL
Match: F6HHG6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0080g00310 PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 6.6e-24 Identity = 53/84 (63.10%), Postives = 68/84 (80.95%), Query Frame = 3
BLAST of WMU36798 vs. NCBI nr
Match: gi|659071714|ref|XP_008461550.1| (PREDICTED: uncharacterized protein LOC103500119 [Cucumis melo]) HSP 1 Score: 169.9 bits (429), Expect = 4.7e-39 Identity = 77/87 (88.51%), Postives = 80/87 (91.95%), Query Frame = 3
BLAST of WMU36798 vs. NCBI nr
Match: gi|778659417|ref|XP_011654388.1| (PREDICTED: uncharacterized protein LOC101204358 [Cucumis sativus]) HSP 1 Score: 167.9 bits (424), Expect = 1.8e-38 Identity = 77/87 (88.51%), Postives = 79/87 (90.80%), Query Frame = 3
BLAST of WMU36798 vs. NCBI nr
Match: gi|700197498|gb|KGN52675.1| (hypothetical protein Csa_5G650285 [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 2.1e-26 Identity = 55/86 (63.95%), Postives = 69/86 (80.23%), Query Frame = 3
BLAST of WMU36798 vs. NCBI nr
Match: gi|657997445|ref|XP_008391106.1| (PREDICTED: uncharacterized protein LOC103453342 [Malus domestica]) HSP 1 Score: 127.9 bits (320), Expect = 2.1e-26 Identity = 58/84 (69.05%), Postives = 67/84 (79.76%), Query Frame = 3
BLAST of WMU36798 vs. NCBI nr
Match: gi|449447761|ref|XP_004141636.1| (PREDICTED: uncharacterized protein LOC101207495 [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 2.1e-26 Identity = 55/86 (63.95%), Postives = 69/86 (80.23%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|