WMU32211 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CATGGAGGTGTAGAGATGCTGGGGTGGTGCACATACTGGGGAAACACTGTAATTAGAGCAAGAAGGGAATCAAAATTCTACAAGAAGATAGCTGTTGATTACATATATGCCTTTCTTAGAAAGATTTGCAGGGGAGAATAGTGTGATTTTCAATGTTCCTCATGAGAGTCTATTAAACGTTGGCCAAATTTTCTATGTATAGTTCATTTAATTTTAGTGATGGAATAGAGTGTGAATCAAATCTGTTACATAAAAAAACTT
BLAST of WMU32211 vs. TAIR10
Match: AT2G35060.2 (AT2G35060.2 K+ uptake permease 11) HSP 1 Score: 62.4 bits (150), Expect = 1.6e-10 Identity = 26/31 (83.87%), Postives = 29/31 (93.55%), Query Frame = 1
HSP 2 Score: 45.8 bits (107), Expect = 1.5e-05 Identity = 21/29 (72.41%), Postives = 22/29 (75.86%), Query Frame = 2
BLAST of WMU32211 vs. TAIR10
Match: AT1G31120.1 (AT1G31120.1 K+ uptake permease 10) HSP 1 Score: 61.2 bits (147), Expect = 3.6e-10 Identity = 25/31 (80.65%), Postives = 29/31 (93.55%), Query Frame = 1
HSP 2 Score: 47.4 bits (111), Expect = 5.3e-06 Identity = 22/29 (75.86%), Postives = 21/29 (72.41%), Query Frame = 2
BLAST of WMU32211 vs. TAIR10
Match: AT4G19960.1 (AT4G19960.1 K+ uptake permease 9) HSP 1 Score: 47.0 bits (110), Expect = 7.0e-06 Identity = 21/31 (67.74%), Postives = 23/31 (74.19%), Query Frame = 1
HSP 2 Score: 43.5 bits (101), Expect = 7.6e-05 Identity = 19/29 (65.52%), Postives = 21/29 (72.41%), Query Frame = 2
BLAST of WMU32211 vs. Swiss-Prot
Match: POT11_ARATH (Potassium transporter 11 OS=Arabidopsis thaliana GN=POT11 PE=2 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 2.8e-09 Identity = 26/31 (83.87%), Postives = 29/31 (93.55%), Query Frame = 1
HSP 2 Score: 45.8 bits (107), Expect = 2.7e-04 Identity = 21/29 (72.41%), Postives = 22/29 (75.86%), Query Frame = 2
BLAST of WMU32211 vs. Swiss-Prot
Match: POT10_ARATH (Potassium transporter 10 OS=Arabidopsis thaliana GN=POT10 PE=2 SV=2) HSP 1 Score: 61.2 bits (147), Expect = 6.3e-09 Identity = 25/31 (80.65%), Postives = 29/31 (93.55%), Query Frame = 1
HSP 2 Score: 47.4 bits (111), Expect = 9.4e-05 Identity = 22/29 (75.86%), Postives = 21/29 (72.41%), Query Frame = 2
BLAST of WMU32211 vs. Swiss-Prot
Match: HAK18_ORYSJ (Potassium transporter 18 OS=Oryza sativa subsp. japonica GN=HAK18 PE=2 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.0e-06 Identity = 24/31 (77.42%), Postives = 26/31 (83.87%), Query Frame = 1
HSP 2 Score: 51.6 bits (122), Expect = 5.0e-06 Identity = 24/37 (64.86%), Postives = 27/37 (72.97%), Query Frame = 2
BLAST of WMU32211 vs. Swiss-Prot
Match: HAK11_ORYSJ (Probable potassium transporter 11 OS=Oryza sativa subsp. japonica GN=HAK11 PE=2 SV=4) HSP 1 Score: 50.8 bits (120), Expect = 8.5e-06 Identity = 23/37 (62.16%), Postives = 27/37 (72.97%), Query Frame = 2
HSP 2 Score: 49.3 bits (116), Expect = 2.5e-05 Identity = 21/31 (67.74%), Postives = 25/31 (80.65%), Query Frame = 1
BLAST of WMU32211 vs. TrEMBL
Match: A0A0A0LRC4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G057060 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.9e-08 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. TrEMBL
Match: A0A0A0LRC4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G057060 PE=4 SV=1) HSP 1 Score: 50.1 bits (118), Expect = 1.6e-03 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 2
HSP 2 Score: 29.6 bits (65), Expect = 2.2e+03 Identity = 12/12 (100.00%), Postives = 12/12 (100.00%), Query Frame = 3
HSP 3 Score: 64.3 bits (155), Expect = 8.3e-08 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. TrEMBL
Match: V7CL30_PHAVU (Potassium transporter OS=Phaseolus vulgaris GN=PHAVU_002G191100g PE=3 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 4.2e-04 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 2
HSP 2 Score: 64.3 bits (155), Expect = 8.3e-08 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. TrEMBL
Match: A0A0B2R0X0_GLYSO (Potassium transporter OS=Glycine soja GN=glysoja_018763 PE=3 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 4.2e-04 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 2
HSP 2 Score: 64.3 bits (155), Expect = 8.3e-08 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. TrEMBL
Match: V7CNF1_PHAVU (Potassium transporter OS=Phaseolus vulgaris GN=PHAVU_002G191100g PE=3 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 4.2e-04 Identity = 24/29 (82.76%), Postives = 25/29 (86.21%), Query Frame = 2
HSP 2 Score: 64.3 bits (155), Expect = 8.3e-08 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. NCBI nr
Match: gi|778658295|ref|XP_011652452.1| (PREDICTED: potassium transporter 10-like [Cucumis sativus]) HSP 1 Score: 67.4 bits (163), Expect = 1.4e-08 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. NCBI nr
Match: gi|700209374|gb|KGN64470.1| (hypothetical protein Csa_1G057060 [Cucumis sativus]) HSP 1 Score: 67.4 bits (163), Expect = 1.4e-08 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. NCBI nr
Match: gi|659067648|ref|XP_008440560.1| (PREDICTED: potassium transporter 11-like [Cucumis melo]) HSP 1 Score: 67.0 bits (162), Expect = 1.8e-08 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. NCBI nr
Match: gi|955320715|ref|XP_014631125.1| (PREDICTED: potassium transporter 10 isoform X1 [Glycine max]) HSP 1 Score: 65.9 bits (159), Expect = 4.1e-08 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU32211 vs. NCBI nr
Match: gi|702352483|ref|XP_010058035.1| (PREDICTED: potassium transporter 10-like [Eucalyptus grandis]) HSP 1 Score: 65.9 bits (159), Expect = 4.1e-08 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|