WMU31652 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATGGCAGCAAGTTTTAACTTTTCACAGCCCTTCTTTGTTACATGGGATAGAATACTTGGTACCTATATGCCTTACTCCTTGGAGAAGAGAGCAGGTGGCGGCTTTGAAGCGCGGCCAAAGATTGAATAAATACTGTAAGCAGCAATCTGTTGCTTATATTATATTATTTGTATCCCACAACTATATAATTTGTATATTACTCCTATTGTTGCTATTTTTATTACTTTTTTTTTTCTTTCCTCTTCCTCTCTCCTACC
BLAST of WMU31652 vs. TAIR10
Match: AT1G69640.1 (AT1G69640.1 sphingoid base hydroxylase 1) HSP 1 Score: 71.6 bits (174), Expect = 2.6e-13 Identity = 32/38 (84.21%), Postives = 31/38 (81.58%), Query Frame = 1
BLAST of WMU31652 vs. TAIR10
Match: AT1G14290.1 (AT1G14290.1 sphingoid base hydroxylase 2) HSP 1 Score: 70.9 bits (172), Expect = 4.4e-13 Identity = 30/35 (85.71%), Postives = 30/35 (85.71%), Query Frame = 1
BLAST of WMU31652 vs. Swiss-Prot
Match: SBH1_ARATH (Sphinganine C4-monooxygenase 1 OS=Arabidopsis thaliana GN=SBH1 PE=1 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 4.6e-12 Identity = 32/38 (84.21%), Postives = 31/38 (81.58%), Query Frame = 1
BLAST of WMU31652 vs. Swiss-Prot
Match: SBH2_ARATH (Sphinganine C4-monooxygenase 2 OS=Arabidopsis thaliana GN=SBH2 PE=1 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 7.8e-12 Identity = 30/35 (85.71%), Postives = 30/35 (85.71%), Query Frame = 1
BLAST of WMU31652 vs. TrEMBL
Match: A0A0A0LJX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G101090 PE=3 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 2.2e-13 Identity = 37/40 (92.50%), Postives = 38/40 (95.00%), Query Frame = 1
BLAST of WMU31652 vs. TrEMBL
Match: A0A0A0KQL6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G605020 PE=3 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.5e-11 Identity = 33/38 (86.84%), Postives = 35/38 (92.11%), Query Frame = 1
BLAST of WMU31652 vs. TrEMBL
Match: W9QTZ8_9ROSA (Sphingoid base hydroxylase 2 OS=Morus notabilis GN=L484_003195 PE=3 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 4.6e-11 Identity = 32/37 (86.49%), Postives = 35/37 (94.59%), Query Frame = 1
BLAST of WMU31652 vs. TrEMBL
Match: W1NGV5_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00010p00259130 PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 6.0e-11 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 1
BLAST of WMU31652 vs. TrEMBL
Match: M5XMN9_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa010258mg PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 6.0e-11 Identity = 32/38 (84.21%), Postives = 35/38 (92.11%), Query Frame = 1
BLAST of WMU31652 vs. NCBI nr
Match: gi|659082180|ref|XP_008441706.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Cucumis melo]) HSP 1 Score: 86.3 bits (212), Expect = 2.9e-14 Identity = 38/40 (95.00%), Postives = 39/40 (97.50%), Query Frame = 1
BLAST of WMU31652 vs. NCBI nr
Match: gi|449442297|ref|XP_004138918.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Cucumis sativus]) HSP 1 Score: 84.0 bits (206), Expect = 1.4e-13 Identity = 37/40 (92.50%), Postives = 38/40 (95.00%), Query Frame = 1
BLAST of WMU31652 vs. NCBI nr
Match: gi|700206260|gb|KGN61379.1| (hypothetical protein Csa_2G101090 [Cucumis sativus]) HSP 1 Score: 84.0 bits (206), Expect = 1.4e-13 Identity = 37/40 (92.50%), Postives = 38/40 (95.00%), Query Frame = 1
BLAST of WMU31652 vs. NCBI nr
Match: gi|694361203|ref|XP_009360346.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Pyrus x bretschneideri]) HSP 1 Score: 77.0 bits (188), Expect = 1.7e-11 Identity = 33/36 (91.67%), Postives = 34/36 (94.44%), Query Frame = 1
BLAST of WMU31652 vs. NCBI nr
Match: gi|657994337|ref|XP_008389473.1| (PREDICTED: sphinganine C(4)-monooxygenase 1 [Malus domestica]) HSP 1 Score: 76.6 bits (187), Expect = 2.3e-11 Identity = 33/36 (91.67%), Postives = 34/36 (94.44%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|