WMU31448 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TCAAGAGGAGCGTCTATCAACCAATATAAGGTTCCGAGGTGTGTGAATTTTACTCCCATTATGGAACTTCTCGATTCTAGAGTAGTATCGGCGCACTTTTAGTCCTGCTCTGCCACATTGGACTCCAGCTAGGACACGCTAATTTCTTTTTTTTTTCTTTTTCTTTTTCTTTTCTTTTCTTTTCTTTAA
BLAST of WMU31448 vs. TAIR10
Match: AT2G14960.1 (AT2G14960.1 Auxin-responsive GH3 family protein) HSP 1 Score: 68.6 bits (166), Expect = 1.6e-12 Identity = 32/33 (96.97%), Postives = 31/33 (93.94%), Query Frame = 1
BLAST of WMU31448 vs. TAIR10
Match: AT4G37390.1 (AT4G37390.1 Auxin-responsive GH3 family protein) HSP 1 Score: 68.2 bits (165), Expect = 2.1e-12 Identity = 32/33 (96.97%), Postives = 31/33 (93.94%), Query Frame = 1
BLAST of WMU31448 vs. TAIR10
Match: AT2G23170.1 (AT2G23170.1 Auxin-responsive GH3 family protein) HSP 1 Score: 66.6 bits (161), Expect = 6.1e-12 Identity = 31/33 (93.94%), Postives = 30/33 (90.91%), Query Frame = 1
BLAST of WMU31448 vs. TAIR10
Match: AT1G59500.1 (AT1G59500.1 Auxin-responsive GH3 family protein) HSP 1 Score: 63.2 bits (152), Expect = 6.8e-11 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 1
BLAST of WMU31448 vs. TAIR10
Match: AT4G27260.1 (AT4G27260.1 Auxin-responsive GH3 family protein) HSP 1 Score: 53.1 bits (126), Expect = 7.0e-08 Identity = 24/33 (72.73%), Postives = 26/33 (78.79%), Query Frame = 1
BLAST of WMU31448 vs. Swiss-Prot
Match: GH31_ARATH (Probable indole-3-acetic acid-amido synthetase GH3.1 OS=Arabidopsis thaliana GN=GH3.1 PE=2 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 2.9e-11 Identity = 32/33 (96.97%), Postives = 31/33 (93.94%), Query Frame = 1
BLAST of WMU31448 vs. Swiss-Prot
Match: GH33_ARATH (Indole-3-acetic acid-amido synthetase GH3.3 OS=Arabidopsis thaliana GN=GH3.3 PE=1 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.1e-10 Identity = 31/33 (93.94%), Postives = 30/33 (90.91%), Query Frame = 1
BLAST of WMU31448 vs. Swiss-Prot
Match: GH34_ARATH (Indole-3-acetic acid-amido synthetase GH3.4 OS=Arabidopsis thaliana GN=GH3.4 PE=1 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.2e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 1
BLAST of WMU31448 vs. Swiss-Prot
Match: GH38_ORYSI (Probable indole-3-acetic acid-amido synthetase GH3.8 OS=Oryza sativa subsp. indica GN=GH3.8 PE=2 SV=2) HSP 1 Score: 62.8 bits (151), Expect = 1.6e-09 Identity = 29/33 (87.88%), Postives = 29/33 (87.88%), Query Frame = 1
BLAST of WMU31448 vs. Swiss-Prot
Match: GH38_ORYSJ (Probable indole-3-acetic acid-amido synthetase GH3.8 OS=Oryza sativa subsp. japonica GN=GH3.8 PE=2 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.6e-09 Identity = 29/33 (87.88%), Postives = 29/33 (87.88%), Query Frame = 1
BLAST of WMU31448 vs. TrEMBL
Match: A0A0K9RRS3_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_036850 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.1e-09 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. TrEMBL
Match: A0A0D2W2X4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_013G048400 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.1e-09 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. TrEMBL
Match: A0A061E230_THECC (Auxin-responsive GH3 family protein OS=Theobroma cacao GN=TCM_007172 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.1e-09 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. TrEMBL
Match: A0A0D2R7H1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G021400 PE=4 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.4e-09 Identity = 32/33 (96.97%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. TrEMBL
Match: F6H697_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_03s0091g00310 PE=1 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.4e-09 Identity = 32/33 (96.97%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. NCBI nr
Match: gi|902231172|gb|KNA22163.1| (hypothetical protein SOVF_036850 [Spinacia oleracea]) HSP 1 Score: 72.0 bits (175), Expect = 4.1e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. NCBI nr
Match: gi|823260548|ref|XP_012462997.1| (PREDICTED: probable indole-3-acetic acid-amido synthetase GH3.1 [Gossypium raimondii]) HSP 1 Score: 72.0 bits (175), Expect = 4.1e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. NCBI nr
Match: gi|1009170815|ref|XP_015866400.1| (PREDICTED: probable indole-3-acetic acid-amido synthetase GH3.1 [Ziziphus jujuba]) HSP 1 Score: 72.0 bits (175), Expect = 4.1e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. NCBI nr
Match: gi|590687104|ref|XP_007042570.1| (Auxin-responsive GH3 family protein [Theobroma cacao]) HSP 1 Score: 72.0 bits (175), Expect = 4.1e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = 1
BLAST of WMU31448 vs. NCBI nr
Match: gi|976905700|gb|KVH93320.1| (GH3 auxin-responsive promoter [Cynara cardunculus var. scolymus]) HSP 1 Score: 70.9 bits (172), Expect = 9.2e-10 Identity = 32/33 (96.97%), Postives = 33/33 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|