WMU29470 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TTTGACTTCATTGCATGACATTAGTGATGAGCCTGTCTGCATGACACCCTTCAGCTTTGATTTCGAGCAGCATGCGCTTACCGAGGAACAGATGAAAGAGCTGATCTATCTAGAGGCGCTTGCATTTTAACCCCGAGTATCATCACCAATAATAAGCTATGTTATTTACTGGAGGATTGTTTGATCTGTATGATCCCTTTATTCTGTATGTTCATTATTAATTCCTTTGTGTATATTAACTGCATTCACTACTTGATGGGCTTTGGAATCAAAATTTGTCTGAGTATGGGCCAGAATTAGGACTGGAAGAATCTTCATGAACTTGTATCTGCCTTTTCTACTTCTTTCTACTACTTGTCATATTGTTCATACT
BLAST of WMU29470 vs. TAIR10
Match: AT2G43790.1 (AT2G43790.1 MAP kinase 6) HSP 1 Score: 73.9 bits (180), Expect = 7.6e-14 Identity = 35/44 (79.55%), Postives = 35/44 (79.55%), Query Frame = 2
BLAST of WMU29470 vs. TAIR10
Match: AT3G59790.1 (AT3G59790.1 MAP kinase 10) HSP 1 Score: 64.7 bits (156), Expect = 4.6e-11 Identity = 28/48 (58.33%), Postives = 34/48 (70.83%), Query Frame = 2
BLAST of WMU29470 vs. TAIR10
Match: AT4G01370.1 (AT4G01370.1 MAP kinase 4) HSP 1 Score: 63.2 bits (152), Expect = 1.3e-10 Identity = 29/47 (61.70%), Postives = 34/47 (72.34%), Query Frame = 2
BLAST of WMU29470 vs. TAIR10
Match: AT3G45640.1 (AT3G45640.1 mitogen-activated protein kinase 3) HSP 1 Score: 61.2 bits (147), Expect = 5.1e-10 Identity = 27/44 (61.36%), Postives = 31/44 (70.45%), Query Frame = 2
BLAST of WMU29470 vs. TAIR10
Match: AT1G01560.2 (AT1G01560.2 MAP kinase 11) HSP 1 Score: 58.9 bits (141), Expect = 2.5e-09 Identity = 26/44 (59.09%), Postives = 32/44 (72.73%), Query Frame = 2
BLAST of WMU29470 vs. Swiss-Prot
Match: MMK1_MEDSA (Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa GN=MMK1 PE=1 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-16 Identity = 42/44 (95.45%), Postives = 40/44 (90.91%), Query Frame = 2
BLAST of WMU29470 vs. Swiss-Prot
Match: MPK_PEA (Mitogen-activated protein kinase homolog D5 OS=Pisum sativum PE=2 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 5.8e-16 Identity = 41/44 (93.18%), Postives = 39/44 (88.64%), Query Frame = 2
BLAST of WMU29470 vs. Swiss-Prot
Match: NTF4_TOBAC (Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum GN=NTF4 PE=2 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 7.6e-16 Identity = 40/44 (90.91%), Postives = 39/44 (88.64%), Query Frame = 2
BLAST of WMU29470 vs. Swiss-Prot
Match: MPK1_ORYSJ (Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica GN=MPK1 PE=1 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 1.2e-13 Identity = 36/44 (81.82%), Postives = 38/44 (86.36%), Query Frame = 2
BLAST of WMU29470 vs. Swiss-Prot
Match: MPK6_ARATH (Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana GN=MPK6 PE=1 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.3e-12 Identity = 35/44 (79.55%), Postives = 35/44 (79.55%), Query Frame = 2
BLAST of WMU29470 vs. TrEMBL
Match: A0A0A0KIN6_CUCSA (Mitogen-activated protein kinase OS=Cucumis sativus GN=Csa_6G365750 PE=3 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 2.6e-15 Identity = 43/44 (97.73%), Postives = 43/44 (97.73%), Query Frame = 2
BLAST of WMU29470 vs. TrEMBL
Match: G7JNP9_MEDTR (Mitogen-activated protein kinase OS=Medicago truncatula GN=MTR_4g087620 PE=3 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.3e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 2
BLAST of WMU29470 vs. TrEMBL
Match: G8C6K8_GOSHI (Mitogen-activated protein kinase OS=Gossypium hirsutum GN=MPK6 PE=2 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.3e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 2
BLAST of WMU29470 vs. TrEMBL
Match: Q9M534_EUPES (Mitogen-activated protein kinase OS=Euphorbia esula PE=2 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.3e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 2
BLAST of WMU29470 vs. TrEMBL
Match: A0A0D2RJY3_GOSRA (Mitogen-activated protein kinase OS=Gossypium raimondii GN=B456_005G123100 PE=3 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.3e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 2
BLAST of WMU29470 vs. NCBI nr
Match: gi|449452881|ref|XP_004144187.1| (PREDICTED: mitogen-activated protein kinase homolog MMK1 [Cucumis sativus]) HSP 1 Score: 89.7 bits (221), Expect = 3.8e-15 Identity = 43/44 (97.73%), Postives = 43/44 (97.73%), Query Frame = 2
BLAST of WMU29470 vs. NCBI nr
Match: gi|659089394|ref|XP_008445483.1| (PREDICTED: mitogen-activated protein kinase homolog MMK1 isoform X1 [Cucumis melo]) HSP 1 Score: 89.7 bits (221), Expect = 3.8e-15 Identity = 43/44 (97.73%), Postives = 43/44 (97.73%), Query Frame = 2
BLAST of WMU29470 vs. NCBI nr
Match: gi|659089396|ref|XP_008445484.1| (PREDICTED: mitogen-activated protein kinase homolog D5 isoform X2 [Cucumis melo]) HSP 1 Score: 89.7 bits (221), Expect = 3.8e-15 Identity = 43/44 (97.73%), Postives = 43/44 (97.73%), Query Frame = 2
BLAST of WMU29470 vs. NCBI nr
Match: gi|645275921|ref|XP_008243044.1| (PREDICTED: mitogen-activated protein kinase homolog MMK1 [Prunus mume]) HSP 1 Score: 87.4 bits (215), Expect = 1.9e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 2
BLAST of WMU29470 vs. NCBI nr
Match: gi|954331214|gb|ALP46220.1| (mitogen-activated protein kinase 5 [Prunus cerasus x Prunus canescens]) HSP 1 Score: 87.4 bits (215), Expect = 1.9e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|