WMU29106 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGCTGGTGGCTGCCACTCGTTTTGGCGCGGCAAAGCTCCAAAAACACTCCGCTTCAATCAACTACCAAACCATCTCTCTCTCTTCGGCGATTCAATGTTTGTAAATTGTAATGGCGACCATCTTCTCTTTTCAATCACATTCTTCCCTCCAGACCTCTCTCAATGCCATTCGACCTAATCGCCCTCTCGGAATCTGCAGAATCCAGTGCCAGGGAAATAATTTCCGCTACCCATTCGCCGAAGAATCAAGAATCCAAGCCCGAGAATGCGGTGCTGAAGGTCGCTTGGTATGGCTCCGAGCTCTTGGGGATCGCCGCTTCATTTCTCCGCCCCCCGTCGGATGTCGAAACTCCCGTTAGGGCTCAGGAGCTCGCCAGAGATCTGTCCGGTGCAATTCCTCGCCCGCTGATCGTGGAAACGATTAAGCAGGATTTTGGGCGGTACGTGTTTCGTCACAGGGAACCTTACTCTTGAAGCTTACGAAGAGGAGTGTGAATTTGCTGAT
BLAST of WMU29106 vs. TAIR10
Match: AT2G46100.1 (AT2G46100.1 Nuclear transport factor 2 (NTF2) family protein) HSP 1 Score: 62.4 bits (150), Expect = 3.1e-10 Identity = 35/75 (46.67%), Postives = 44/75 (58.67%), Query Frame = 1
HSP 2 Score: 37.7 bits (86), Expect = 8.2e-03 Identity = 16/19 (84.21%), Postives = 15/19 (78.95%), Query Frame = 2
BLAST of WMU29106 vs. TrEMBL
Match: A0A0A0K7I1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G006760 PE=4 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 2.2e-25 Identity = 60/74 (81.08%), Postives = 66/74 (89.19%), Query Frame = 1
BLAST of WMU29106 vs. TrEMBL
Match: A0A0A0K7I1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G006760 PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.8e-06 Identity = 29/37 (78.38%), Postives = 30/37 (81.08%), Query Frame = 3
HSP 2 Score: 43.1 bits (100), Expect = 3.8e-01 Identity = 28/74 (37.84%), Postives = 38/74 (51.35%), Query Frame = 2
HSP 3 Score: 95.1 bits (235), Expect = 8.5e-17 Identity = 49/74 (66.22%), Postives = 57/74 (77.03%), Query Frame = 1
BLAST of WMU29106 vs. TrEMBL
Match: F6I656_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_15s0046g02050 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 1.9e+00 Identity = 27/74 (36.49%), Postives = 38/74 (51.35%), Query Frame = 2
HSP 2 Score: 88.6 bits (218), Expect = 8.0e-15 Identity = 45/73 (61.64%), Postives = 55/73 (75.34%), Query Frame = 1
BLAST of WMU29106 vs. TrEMBL
Match: M5X274_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011338mg PE=4 SV=1) HSP 1 Score: 41.2 bits (95), Expect = 1.5e+00 Identity = 17/19 (89.47%), Postives = 19/19 (100.00%), Query Frame = 2
HSP 2 Score: 88.6 bits (218), Expect = 8.0e-15 Identity = 47/72 (65.28%), Postives = 53/72 (73.61%), Query Frame = 1
BLAST of WMU29106 vs. TrEMBL
Match: A0A061DSV4_THECC (Nuclear transport factor 2 family protein OS=Theobroma cacao GN=TCM_005275 PE=4 SV=1) HSP 1 Score: 38.1 bits (87), Expect = 1.2e+01 Identity = 16/19 (84.21%), Postives = 17/19 (89.47%), Query Frame = 2
HSP 2 Score: 84.0 bits (206), Expect = 2.0e-13 Identity = 41/67 (61.19%), Postives = 48/67 (71.64%), Query Frame = 1
BLAST of WMU29106 vs. NCBI nr
Match: gi|659116628|ref|XP_008458172.1| (PREDICTED: uncharacterized protein LOC103497690 [Cucumis melo]) HSP 1 Score: 132.5 bits (332), Expect = 6.9e-28 Identity = 64/74 (86.49%), Postives = 67/74 (90.54%), Query Frame = 1
BLAST of WMU29106 vs. NCBI nr
Match: gi|449441428|ref|XP_004138484.1| (PREDICTED: uncharacterized protein LOC101218208 [Cucumis sativus]) HSP 1 Score: 126.7 bits (317), Expect = 3.8e-26 Identity = 60/74 (81.08%), Postives = 66/74 (89.19%), Query Frame = 1
BLAST of WMU29106 vs. NCBI nr
Match: gi|700190486|gb|KGN45690.1| (hypothetical protein Csa_6G006760 [Cucumis sativus]) HSP 1 Score: 126.7 bits (317), Expect = 3.8e-26 Identity = 60/74 (81.08%), Postives = 66/74 (89.19%), Query Frame = 1
BLAST of WMU29106 vs. NCBI nr
Match: gi|225454326|ref|XP_002277369.1| (PREDICTED: uncharacterized protein LOC100258452 [Vitis vinifera]) HSP 1 Score: 98.2 bits (243), Expect = 1.4e-17 Identity = 49/74 (66.22%), Postives = 57/74 (77.03%), Query Frame = 1
BLAST of WMU29106 vs. NCBI nr
Match: gi|297745341|emb|CBI40421.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 98.2 bits (243), Expect = 1.4e-17 Identity = 49/74 (66.22%), Postives = 57/74 (77.03%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|