WMU28470 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGTATGGGAAATTTGAAAAAAAAGAACATTCTTTCTCCAACTTTTAATCGGTTTCCCTAGCTGTCCTCACAAGATGGATTATGCGATACTGAAGCTTAGCATTTTCTTGCAGCAACCATCTCAGCCTTTTTCCGTTCTTCGATTAGCGCTTCGTTTGTGCTGTCTAGCTTCGACTGGAGTTCGCTTATTGTTTTCAGATGATCTTTGTTATGGACGTCTTTCTTACTCAAGAGTGCATCTTCTAATCTTGACAAAACGATCCTCAGCTTCAGAAGCTCTTTGGAAGAAGGGCTTCAAGGTCTGCTCAAGATCGTAGTTGACGCCGCCAAATGGTTCCGCCATTGTTGCCAAACTTCCAACTTC
BLAST of WMU28470 vs. NCBI nr
Match: gi|659129281|ref|XP_008464609.1| (PREDICTED: uncharacterized protein LOC103502450 isoform X2 [Cucumis melo]) HSP 1 Score: 76.6 bits (187), Expect = 3.2e-11 Identity = 41/48 (85.42%), Postives = 44/48 (91.67%), Query Frame = -2
BLAST of WMU28470 vs. NCBI nr
Match: gi|659129279|ref|XP_008464608.1| (PREDICTED: uncharacterized protein LOC103502450 isoform X1 [Cucumis melo]) HSP 1 Score: 72.8 bits (177), Expect = 4.6e-10 Identity = 38/49 (77.55%), Postives = 43/49 (87.76%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|