WMU28320 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AACAATGGCGGAACCATTTGGCGGCGTCAACTACGATCCTTGAGCAGACCTTGAAGCCCCTTCTTCCAAAAGAGCTTCTGAAGCTGAGGATCGTTTGTCAAGATTAGAAGATGCACTCTTGAGTAAGAAAGACGTCCATAACAAAGATCATCTGAAAACAATAAGCGGACTCCAGTCGAAGCTAGACAGCACAAACGAAGCGCTAATCGAAGAACGGAAAAAGGCTGAGATGGTTGCTGCAGAAAATGCTAAGCTTCAGTATCGACAATAAATACCAATACTTGTGAGGACAGCTAGGGAAACCGATTAAAAG
BLAST of WMU28320 vs. TAIR10
Match: AT3G57320.1 (AT3G57320.1 unknown protein) HSP 1 Score: 51.2 bits (121), Expect = 4.4e-07 Identity = 34/86 (39.53%), Postives = 50/86 (58.14%), Query Frame = 2
BLAST of WMU28320 vs. TrEMBL
Match: A0A067JTC8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_21121 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.4e-14 Identity = 52/89 (58.43%), Postives = 61/89 (68.54%), Query Frame = 2
BLAST of WMU28320 vs. TrEMBL
Match: A0A0B2S9Y2_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_048169 PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 7.1e-14 Identity = 49/85 (57.65%), Postives = 62/85 (72.94%), Query Frame = 2
BLAST of WMU28320 vs. TrEMBL
Match: C6T3Q4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_10G107400 PE=2 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 7.1e-14 Identity = 49/85 (57.65%), Postives = 62/85 (72.94%), Query Frame = 2
BLAST of WMU28320 vs. TrEMBL
Match: A9PB69_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0006s04540g PE=2 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.5e-13 Identity = 46/85 (54.12%), Postives = 60/85 (70.59%), Query Frame = 2
BLAST of WMU28320 vs. TrEMBL
Match: B9H9I5_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0006s04540g PE=4 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.5e-13 Identity = 46/85 (54.12%), Postives = 60/85 (70.59%), Query Frame = 2
BLAST of WMU28320 vs. NCBI nr
Match: gi|659129281|ref|XP_008464609.1| (PREDICTED: uncharacterized protein LOC103502450 isoform X2 [Cucumis melo]) HSP 1 Score: 123.2 bits (308), Expect = 2.6e-25 Identity = 74/100 (74.00%), Postives = 81/100 (81.00%), Query Frame = 2
BLAST of WMU28320 vs. NCBI nr
Match: gi|659129279|ref|XP_008464608.1| (PREDICTED: uncharacterized protein LOC103502450 isoform X1 [Cucumis melo]) HSP 1 Score: 95.1 bits (235), Expect = 7.6e-17 Identity = 54/79 (68.35%), Postives = 63/79 (79.75%), Query Frame = 2
BLAST of WMU28320 vs. NCBI nr
Match: gi|1009159888|ref|XP_015898059.1| (PREDICTED: uncharacterized protein LOC107431605 [Ziziphus jujuba]) HSP 1 Score: 87.8 bits (216), Expect = 1.2e-14 Identity = 52/85 (61.18%), Postives = 62/85 (72.94%), Query Frame = 2
BLAST of WMU28320 vs. NCBI nr
Match: gi|802730501|ref|XP_012086217.1| (PREDICTED: uncharacterized protein LOC105645264 isoform X2 [Jatropha curcas]) HSP 1 Score: 83.6 bits (205), Expect = 2.3e-13 Identity = 52/89 (58.43%), Postives = 61/89 (68.54%), Query Frame = 2
BLAST of WMU28320 vs. NCBI nr
Match: gi|351724963|ref|NP_001236820.1| (uncharacterized protein LOC100527237 [Glycine max]) HSP 1 Score: 81.3 bits (199), Expect = 1.1e-12 Identity = 49/85 (57.65%), Postives = 62/85 (72.94%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|