WMU17069 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCATTTTTATTCTAGCTCAGTGCTGTATTGGTTGTATGATAAAGAATCTATTCTGGAAACTAAGTCGAAAGCAGCAATTAAACTCGTTGATTTTGCACACGTTGTAGATAGCAATGGTGCTATTGATCATAATTTCTTGGGGTGGGATCTGTTCTTTGATCAAATTTATCTCGGAAAGTTTTGACCGATCATATATCGACTGCCTGAACAAAACTTGTCTGCCATGCTCTGATAATAGTTTCAACTGCAACGGCGACGGCTCTGATTGGTAAGTACCTATCAACGTTTGAACATTTTTGTTTATGAAGAAGGATTATATCAGTGTTCTAACTCTGAATGGTAATCCCCATATGCTTTTATCTTATGAAACAAACTCACCAAATGCCATTACTTGTTGGAACTTTAGGAACAAAATTTGTTAGAGCAATCGATCAACCCCTTTGTCCAATTTGGTATGGTCTGTAATCTTTTAAAAGTTCTTTCTAATTTATTTCACACGGGTCTTCCCATGTCTGCAGCCTTGAAAGAAATAAAAGCTTAATCGCTAATGCTATGTTTTCGTTTTGAT
BLAST of WMU17069 vs. TAIR10
Match: AT5G07370.2 (AT5G07370.2 inositol polyphosphate kinase 2 alpha) HSP 1 Score: 54.7 bits (130), Expect = 7.3e-08 Identity = 28/50 (56.00%), Postives = 34/50 (68.00%), Query Frame = 2
BLAST of WMU17069 vs. TAIR10
Match: AT5G61760.1 (AT5G61760.1 inositol polyphosphate kinase 2 beta) HSP 1 Score: 53.9 bits (128), Expect = 1.2e-07 Identity = 29/53 (54.72%), Postives = 33/53 (62.26%), Query Frame = 2
BLAST of WMU17069 vs. Swiss-Prot
Match: IPMKA_ARATH (Inositol polyphosphate multikinase alpha OS=Arabidopsis thaliana GN=IPK2a PE=1 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 1.3e-06 Identity = 28/50 (56.00%), Postives = 34/50 (68.00%), Query Frame = 2
BLAST of WMU17069 vs. Swiss-Prot
Match: IPMKB_ARATH (Inositol polyphosphate multikinase beta OS=Arabidopsis thaliana GN=IPK2b PE=1 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 2.2e-06 Identity = 29/53 (54.72%), Postives = 33/53 (62.26%), Query Frame = 2
BLAST of WMU17069 vs. TrEMBL
Match: A0A0A0KVV1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G009900 PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 3.5e-11 Identity = 39/47 (82.98%), Postives = 41/47 (87.23%), Query Frame = 2
BLAST of WMU17069 vs. TrEMBL
Match: A0A0A0KVV1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G009900 PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 7.6e-06 Identity = 27/42 (64.29%), Postives = 31/42 (73.81%), Query Frame = 3
HSP 2 Score: 62.4 bits (150), Expect = 6.9e-07 Identity = 33/48 (68.75%), Postives = 37/48 (77.08%), Query Frame = 2
BLAST of WMU17069 vs. TrEMBL
Match: A0A164W3R8_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_021389 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.5e-06 Identity = 31/48 (64.58%), Postives = 38/48 (79.17%), Query Frame = 2
BLAST of WMU17069 vs. TrEMBL
Match: A0A059A9M7_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_K03506 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.5e-06 Identity = 28/47 (59.57%), Postives = 37/47 (78.72%), Query Frame = 2
BLAST of WMU17069 vs. TrEMBL
Match: M5WA95_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa009678mg PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 2.0e-06 Identity = 31/48 (64.58%), Postives = 38/48 (79.17%), Query Frame = 2
BLAST of WMU17069 vs. NCBI nr
Match: gi|449468878|ref|XP_004152148.1| (PREDICTED: inositol polyphosphate multikinase alpha [Cucumis sativus]) HSP 1 Score: 76.6 bits (187), Expect = 5.1e-11 Identity = 39/47 (82.98%), Postives = 41/47 (87.23%), Query Frame = 2
BLAST of WMU17069 vs. NCBI nr
Match: gi|659108278|ref|XP_008454112.1| (PREDICTED: inositol polyphosphate multikinase beta-like [Cucumis melo]) HSP 1 Score: 75.9 bits (185), Expect = 8.6e-11 Identity = 39/47 (82.98%), Postives = 40/47 (85.11%), Query Frame = 2
BLAST of WMU17069 vs. NCBI nr
Match: gi|694396808|ref|XP_009373674.1| (PREDICTED: inositol polyphosphate multikinase beta-like [Pyrus x bretschneideri]) HSP 1 Score: 65.9 bits (159), Expect = 8.9e-08 Identity = 34/48 (70.83%), Postives = 39/48 (81.25%), Query Frame = 2
BLAST of WMU17069 vs. NCBI nr
Match: gi|658000465|ref|XP_008392681.1| (PREDICTED: inositol polyphosphate multikinase beta [Malus domestica]) HSP 1 Score: 65.9 bits (159), Expect = 8.9e-08 Identity = 34/48 (70.83%), Postives = 39/48 (81.25%), Query Frame = 2
BLAST of WMU17069 vs. NCBI nr
Match: gi|720055427|ref|XP_010273383.1| (PREDICTED: inositol polyphosphate multikinase beta-like [Nelumbo nucifera]) HSP 1 Score: 65.1 bits (157), Expect = 1.5e-07 Identity = 31/47 (65.96%), Postives = 37/47 (78.72%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|