WMU17044 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGAGCAAGCGTGCTAATAGATGATAACCCAAGATACGCAATCGAATGTGCTGAAGCGGGGATTCGAGTTCTACTTTTCGACTATGAGAATTCATATCCAATGGTGCAAGACTGAATGTGAGGATCTGCCTCCCTTAGTCACTAAAGTTCACAATTGGGAAGAAGTGGAGAAGCAATTAGGTTCTTGTGTTCTTTCTTCTTAAATCAAATTAAGTTTTTAGCTAAAATAGAAAATGCTGTTTTATTTTTACTAATATGAAATGTGGGATTTTGTGGGTTGGAGGAGGTAGTAGGAACTAAGGAATATTGATGATGTAATTGTTTAAGGTTTAGCATTTAGGCCCCAAACTTTTCATTATCCCATAATTGAATTTTCCTCACTTTT
BLAST of WMU17044 vs. TrEMBL
Match: A0A0A0LX27_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G598340 PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.4e-08 Identity = 28/30 (93.33%), Postives = 28/30 (93.33%), Query Frame = 2
BLAST of WMU17044 vs. NCBI nr
Match: gi|778663259|ref|XP_011660045.1| (PREDICTED: uncharacterized protein LOC101215456 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 1.2e-08 Identity = 28/30 (93.33%), Postives = 28/30 (93.33%), Query Frame = 2
BLAST of WMU17044 vs. NCBI nr
Match: gi|659100214|ref|XP_008450985.1| (PREDICTED: uncharacterized protein LOC103492406 isoform X2 [Cucumis melo]) HSP 1 Score: 64.3 bits (155), Expect = 1.7e-07 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 2
BLAST of WMU17044 vs. NCBI nr
Match: gi|659100208|ref|XP_008450982.1| (PREDICTED: uncharacterized protein LOC103492406 isoform X1 [Cucumis melo]) HSP 1 Score: 64.3 bits (155), Expect = 1.7e-07 Identity = 26/30 (86.67%), Postives = 27/30 (90.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|