WMU17002 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GTAAGAAAAAAGGCTCAAATGGCCATTATTTAGAGGTAATTAGATGCAGTATAGTACAGAAAGGCTCAAGTGGCCATTATTTCGTGGTAATTGGATGAAGCATATTACATACCTTTGTTTAGAACACTAATTGTTTAGAGGTAGTCGACTTTAACAATGCATGATCCGGAGGCAGTTATTTATTTAAAGGCGTGCATTAAAGAGACTTAGACATTCATGAGGGTGAATATTCCTTCATATACGGGACTAGTATCACTTCCTGTTATCACGGTCGATAGACATCCGTTCCAATTGTCTGATTTGCTAAGACCCGAATTGTATAATAATTTAGAGATGTAATTCCAATTATCATGCTTATCATAATGTCCCTCTTCACGTATCTCAGTATACGCCGTATTGTTCGAGGATGAATGATCCCACGGATTGGACCAAGCTGCCATCCAATCACAATGTACCTGC
BLAST of WMU17002 vs. Swiss-Prot
Match: JI23_HORVU (23 kDa jasmonate-induced protein OS=Hordeum vulgare PE=2 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 6.1e-07 Identity = 29/76 (38.16%), Postives = 40/76 (52.63%), Query Frame = -2
BLAST of WMU17002 vs. TrEMBL
Match: A0A097BU21_CITLA (23 kDa jasmonate-induced protein OS=Citrullus lanatus PE=2 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 6.1e-30 Identity = 60/81 (74.07%), Postives = 69/81 (85.19%), Query Frame = -2
BLAST of WMU17002 vs. TrEMBL
Match: A0A0A0M0F4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G642550 PE=4 SV=1) HSP 1 Score: 101.3 bits (251), Expect = 1.1e-18 Identity = 48/78 (61.54%), Postives = 56/78 (71.79%), Query Frame = -2
BLAST of WMU17002 vs. TrEMBL
Match: A0A0D2UTY4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G141300 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 8.2e-11 Identity = 31/76 (40.79%), Postives = 46/76 (60.53%), Query Frame = -2
BLAST of WMU17002 vs. TrEMBL
Match: M0T1C5_MUSAM (Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 9.4e-07 Identity = 29/75 (38.67%), Postives = 41/75 (54.67%), Query Frame = -2
BLAST of WMU17002 vs. TrEMBL
Match: M0T1C4_MUSAM (Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 2.1e-06 Identity = 29/75 (38.67%), Postives = 41/75 (54.67%), Query Frame = -2
BLAST of WMU17002 vs. NCBI nr
Match: gi|694188379|gb|AIS71930.1| (23 kDa jasmonate-induced protein [Citrullus lanatus]) HSP 1 Score: 135.6 bits (340), Expect = 7.4e-29 Identity = 60/81 (74.07%), Postives = 69/81 (85.19%), Query Frame = -2
BLAST of WMU17002 vs. NCBI nr
Match: gi|659086035|ref|XP_008443732.1| (PREDICTED: 23 kDa jasmonate-induced protein-like [Cucumis melo]) HSP 1 Score: 110.2 bits (274), Expect = 3.3e-21 Identity = 49/79 (62.03%), Postives = 59/79 (74.68%), Query Frame = -2
BLAST of WMU17002 vs. NCBI nr
Match: gi|743780066|ref|XP_010920410.1| (PREDICTED: 23 kDa jasmonate-induced protein-like [Elaeis guineensis]) HSP 1 Score: 105.1 bits (261), Expect = 1.1e-19 Identity = 45/79 (56.96%), Postives = 57/79 (72.15%), Query Frame = -2
BLAST of WMU17002 vs. NCBI nr
Match: gi|700211516|gb|KGN66612.1| (hypothetical protein Csa_1G642550 [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 1.7e-17 Identity = 48/78 (61.54%), Postives = 56/78 (71.79%), Query Frame = -2
BLAST of WMU17002 vs. NCBI nr
Match: gi|778663970|ref|XP_004139150.2| (PREDICTED: 23 kDa jasmonate-induced protein-like [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 1.7e-17 Identity = 48/78 (61.54%), Postives = 56/78 (71.79%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|