WMU16602 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AACCCAACGCCGAGTTCGTTCGCGAGCTGTTACTTCAGCGACTCGCCGACCAGTTTCAATCTCTCGTCGCCGCCGCTTTCCACCACCACCGCCGTCAGCTTCACGGCGACCTTCCCTTTCTGGACGGA
BLAST of WMU16602 vs. TrEMBL
Match: A0A0A0KK19_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G140530 PE=3 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 1.5e-07 Identity = 34/40 (85.00%), Postives = 35/40 (87.50%), Query Frame = -1
BLAST of WMU16602 vs. NCBI nr
Match: gi|659074287|ref|XP_008437524.1| (PREDICTED: scarecrow-like protein 8 [Cucumis melo]) HSP 1 Score: 62.8 bits (151), Expect = 1.7e-07 Identity = 34/40 (85.00%), Postives = 36/40 (90.00%), Query Frame = -1
BLAST of WMU16602 vs. NCBI nr
Match: gi|778699053|ref|XP_011654649.1| (PREDICTED: scarecrow-like protein 8 [Cucumis sativus]) HSP 1 Score: 62.4 bits (150), Expect = 2.2e-07 Identity = 34/40 (85.00%), Postives = 35/40 (87.50%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|