WMU15204 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ACCCTCTTCCCTTTGATAGTCCCTTCTTCAACACTGATGGGGTTTTCTCCACTAAATCCTTTGCCTCTTTCAGACCTAAATCAGTGAAAACTTCTTACCTCCTTGATAATTTTAATCTTTTGCAGATGCTTCGTTAGACTCTAGTTTCAACTCGTAAACAGTCTTTTCTGCCTTCTTCTCCTCCTTGGCAGTTGCTGATGATGCCTTCATTCCCATTCCAGCCAATCCAGCAGCTCCTGGTTTCATAACTCCAACAACTGGCATGTCTGTCATTCCCAATTTTTCCTCAAAATGGAAGATAATTCAGAAATTTCAACTAATGTGAGCCCAGATATTTCATCTACAAGCCTAAAAACACGATCAGTCGGAGGACTACGGTGCTGTGTTGGATCAAAATTAGCAGGATCGTAATCAGCTGGAAGCCTTCTCTGGTCAATTTCTACCTCTTCCTCTTCCTCCTCTATCCGAGCAGGTTGAGCATAATTTCTATGTAATCCATTTATGTTGAGAGGATTGAGGGGCTAAGAGATGAGATTAAGCGCTGAGGCAGGGAACATGGTGGTTTGAAGTGAGCCGTGAGGACTGTGGATTGCCGATGATAATGGCTGAAGAAGCTTCAATCTCGTCCAGAAGGAGGTGAGTGAGCTCCA
BLAST of WMU15204 vs. TAIR10
Match: AT1G70190.1 (AT1G70190.1 Ribosomal protein L7/L12, oligomerisation;Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like) HSP 1 Score: 53.5 bits (127), Expect = 1.8e-07 Identity = 31/76 (40.79%), Postives = 42/76 (55.26%), Query Frame = -2
BLAST of WMU15204 vs. TrEMBL
Match: A0A0A0LU08_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G057000 PE=3 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 1.1e-24 Identity = 58/72 (80.56%), Postives = 63/72 (87.50%), Query Frame = -1
BLAST of WMU15204 vs. TrEMBL
Match: A0A0A0LU08_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G057000 PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 1.4e-03 Identity = 25/39 (64.10%), Postives = 30/39 (76.92%), Query Frame = -2
HSP 2 Score: 42.4 bits (98), Expect = 8.4e-01 Identity = 25/56 (44.64%), Postives = 27/56 (48.21%), Query Frame = -3
HSP 3 Score: 100.9 bits (250), Expect = 2.0e-18 Identity = 48/52 (92.31%), Postives = 51/52 (98.08%), Query Frame = -1
BLAST of WMU15204 vs. TrEMBL
Match: F6HF68_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_01s0011g01450 PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 1.4e-03 Identity = 25/39 (64.10%), Postives = 30/39 (76.92%), Query Frame = -2
HSP 2 Score: 100.9 bits (250), Expect = 2.0e-18 Identity = 48/52 (92.31%), Postives = 51/52 (98.08%), Query Frame = -1
BLAST of WMU15204 vs. TrEMBL
Match: F6HX03_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_00s2478g00020 PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 1.4e-03 Identity = 25/39 (64.10%), Postives = 30/39 (76.92%), Query Frame = -2
HSP 2 Score: 100.9 bits (250), Expect = 2.0e-18 Identity = 51/70 (72.86%), Postives = 57/70 (81.43%), Query Frame = -1
BLAST of WMU15204 vs. TrEMBL
Match: A0A059CBK4_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_E04306 PE=3 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 3.6e-04 Identity = 26/39 (66.67%), Postives = 31/39 (79.49%), Query Frame = -2
HSP 2 Score: 100.5 bits (249), Expect = 2.6e-18 Identity = 50/70 (71.43%), Postives = 58/70 (82.86%), Query Frame = -1
BLAST of WMU15204 vs. NCBI nr
Match: gi|449454776|ref|XP_004145130.1| (PREDICTED: 54S ribosomal protein L12, mitochondrial [Cucumis sativus]) HSP 1 Score: 122.1 bits (305), Expect = 1.2e-24 Identity = 58/72 (80.56%), Postives = 63/72 (87.50%), Query Frame = -1
BLAST of WMU15204 vs. NCBI nr
Match: gi|659067613|ref|XP_008440389.1| (PREDICTED: 54S ribosomal protein L12, mitochondrial [Cucumis melo]) HSP 1 Score: 121.7 bits (304), Expect = 1.6e-24 Identity = 58/72 (80.56%), Postives = 63/72 (87.50%), Query Frame = -1
BLAST of WMU15204 vs. NCBI nr
Match: gi|747097710|ref|XP_011096828.1| (PREDICTED: 54S ribosomal protein L12, mitochondrial [Sesamum indicum]) HSP 1 Score: 102.4 bits (254), Expect = 9.8e-19 Identity = 51/73 (69.86%), Postives = 60/73 (82.19%), Query Frame = -1
BLAST of WMU15204 vs. NCBI nr
Match: gi|719964277|ref|XP_010252189.1| (PREDICTED: 50S ribosomal protein L12, cyanelle [Nelumbo nucifera]) HSP 1 Score: 102.1 bits (253), Expect = 1.3e-18 Identity = 48/71 (67.61%), Postives = 56/71 (78.87%), Query Frame = -1
BLAST of WMU15204 vs. NCBI nr
Match: gi|970012578|ref|XP_015067232.1| (PREDICTED: 50S ribosomal protein L7/L12-like [Solanum pennellii]) HSP 1 Score: 100.9 bits (250), Expect = 2.9e-18 Identity = 50/70 (71.43%), Postives = 58/70 (82.86%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|