WMU14944 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TTCAACGCAACAAAGAGGGACTCGAGGAGGTTATTTTCCAGGCTCAATGAGGCCTTGGAGAAGAAGAAGAAGGAAATTTCTGACTTGGAGGCCAAATACAAGATCAGGATTAGAAAGCCTGATGGTGAGGCTAAGGAGGAAGACACTGGGCGAAAAAGAAGGGTGCAGCCCAAGGAGTGTTAGTGGGGCCCTGCAGGTGAAAGTTAAACTCTCAACCCAATGGTGAACTTTTATTATATTCTTGTAGTGCTGAACTTTTAGTTTCATCTGATGGTTCACTCTTATAAGCGTGTTTTGTGTTGAAATTTTTGTTTTGACAACTTTCAGTTCAATAGGAAGATTCCAGGACTTGTATGGTATATAGATGATTTTGAGGGGAGGGAAAGTTAGACTTTTAAGTACGTTTTGTACATGGAAAATTTTACTTCTAAGTTTTAGTA
BLAST of WMU14944 vs. TrEMBL
Match: A0A0A0KVR4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G638310 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.7e-13 Identity = 46/64 (71.88%), Postives = 49/64 (76.56%), Query Frame = 1
BLAST of WMU14944 vs. TrEMBL
Match: M1BCJ2_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400016332 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 1.3e-08 Identity = 37/64 (57.81%), Postives = 43/64 (67.19%), Query Frame = 1
BLAST of WMU14944 vs. TrEMBL
Match: A0A0V0HIG2_SOLCH (Putative prefoldin subunit 2-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 1.3e-08 Identity = 37/64 (57.81%), Postives = 43/64 (67.19%), Query Frame = 1
BLAST of WMU14944 vs. TrEMBL
Match: A0A059B3M3_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H03463 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 1.1e-07 Identity = 34/48 (70.83%), Postives = 37/48 (77.08%), Query Frame = 1
BLAST of WMU14944 vs. TrEMBL
Match: K4C633_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 2.4e-07 Identity = 37/64 (57.81%), Postives = 43/64 (67.19%), Query Frame = 1
BLAST of WMU14944 vs. NCBI nr
Match: gi|449447400|ref|XP_004141456.1| (PREDICTED: probable prefoldin subunit 2 [Cucumis sativus]) HSP 1 Score: 78.6 bits (192), Expect = 1.0e-11 Identity = 46/64 (71.88%), Postives = 49/64 (76.56%), Query Frame = 1
BLAST of WMU14944 vs. NCBI nr
Match: gi|659118879|ref|XP_008459357.1| (PREDICTED: probable prefoldin subunit 2 [Cucumis melo]) HSP 1 Score: 73.2 bits (178), Expect = 4.3e-10 Identity = 44/64 (68.75%), Postives = 48/64 (75.00%), Query Frame = 1
BLAST of WMU14944 vs. NCBI nr
Match: gi|565368127|ref|XP_006350704.1| (PREDICTED: probable prefoldin subunit 2 [Solanum tuberosum]) HSP 1 Score: 62.0 bits (149), Expect = 9.9e-07 Identity = 37/64 (57.81%), Postives = 43/64 (67.19%), Query Frame = 1
BLAST of WMU14944 vs. NCBI nr
Match: gi|697136967|ref|XP_009622571.1| (PREDICTED: probable prefoldin subunit 2 [Nicotiana tomentosiformis]) HSP 1 Score: 59.7 bits (143), Expect = 4.9e-06 Identity = 35/64 (54.69%), Postives = 42/64 (65.62%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|