WMU11749 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ACATACAAGATACCGCTACAATTATGGTCACTACTCCATATGGATGGATTGGATGTTTGGGACACTTCTTGATCCAATGGATACAGAAGCCAAAAGGGTTGTGATTGGTTGCTTCGACATGAATTGCTTACTCGTTATAGCTTTTGGGTAATTTGCGAAGCCATTCATACCATCAAATCAAACATTTAATCTCAGAGTTCAGGAATCCACAGAGCCTGTGTGCTGCTGCTGCTGCTATTGGTAAGTAAAACTTGTGGACGCATTTGTTGTATCTTTGTATATCATATTTAAATGAAAACTTGTAGGG
BLAST of WMU11749 vs. TAIR10
Match: AT3G02580.1 (AT3G02580.1 sterol 1) HSP 1 Score: 54.7 bits (130), Expect = 3.9e-08 Identity = 19/26 (73.08%), Postives = 22/26 (84.62%), Query Frame = 2
BLAST of WMU11749 vs. TAIR10
Match: AT3G02590.1 (AT3G02590.1 Fatty acid hydroxylase superfamily protein) HSP 1 Score: 52.8 bits (125), Expect = 1.5e-07 Identity = 18/26 (69.23%), Postives = 22/26 (84.62%), Query Frame = 2
BLAST of WMU11749 vs. Swiss-Prot
Match: SC5D_TOBAC (Delta(7)-sterol-C5(6)-desaturase OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.3e-08 Identity = 22/33 (66.67%), Postives = 27/33 (81.82%), Query Frame = 2
BLAST of WMU11749 vs. Swiss-Prot
Match: SC5D1_ARATH (Delta(7)-sterol-C5(6)-desaturase 1 OS=Arabidopsis thaliana GN=STE1 PE=1 SV=2) HSP 1 Score: 54.7 bits (130), Expect = 6.9e-07 Identity = 19/26 (73.08%), Postives = 22/26 (84.62%), Query Frame = 2
BLAST of WMU11749 vs. Swiss-Prot
Match: SC5D2_ARATH (Putative Delta(7)-sterol-C5(6)-desaturase 2 OS=Arabidopsis thaliana GN=HDF7 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.6e-06 Identity = 18/26 (69.23%), Postives = 22/26 (84.62%), Query Frame = 2
BLAST of WMU11749 vs. TrEMBL
Match: A0A0A0L3B9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G409800 PE=3 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.6e-10 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 2
BLAST of WMU11749 vs. TrEMBL
Match: W9SBF3_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_027055 PE=3 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 3.4e-08 Identity = 25/34 (73.53%), Postives = 31/34 (91.18%), Query Frame = 2
BLAST of WMU11749 vs. TrEMBL
Match: A0A022RY23_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a011765mg PE=3 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 7.5e-08 Identity = 24/33 (72.73%), Postives = 30/33 (90.91%), Query Frame = 2
BLAST of WMU11749 vs. TrEMBL
Match: A0A118K5B7_CYNCS (Uncharacterized protein OS=Cynara cardunculus var. scolymus GN=Ccrd_012760 PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.3e-07 Identity = 23/33 (69.70%), Postives = 29/33 (87.88%), Query Frame = 2
BLAST of WMU11749 vs. TrEMBL
Match: A0A164UFV8_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_025906 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.7e-07 Identity = 23/33 (69.70%), Postives = 30/33 (90.91%), Query Frame = 2
BLAST of WMU11749 vs. NCBI nr
Match: gi|659086753|ref|XP_008444093.1| (PREDICTED: delta(7)-sterol-C5(6)-desaturase-like [Cucumis melo]) HSP 1 Score: 73.6 bits (179), Expect = 2.3e-10 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 2
BLAST of WMU11749 vs. NCBI nr
Match: gi|449465599|ref|XP_004150515.1| (PREDICTED: delta(7)-sterol-C5(6)-desaturase [Cucumis sativus]) HSP 1 Score: 73.6 bits (179), Expect = 2.3e-10 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 2
BLAST of WMU11749 vs. NCBI nr
Match: gi|703146683|ref|XP_010108862.1| (hypothetical protein L484_027055 [Morus notabilis]) HSP 1 Score: 66.2 bits (160), Expect = 3.7e-08 Identity = 25/34 (73.53%), Postives = 31/34 (91.18%), Query Frame = 2
BLAST of WMU11749 vs. NCBI nr
Match: gi|848856022|ref|XP_012854674.1| (PREDICTED: delta(7)-sterol-C5(6)-desaturase [Erythranthe guttata]) HSP 1 Score: 65.1 bits (157), Expect = 8.2e-08 Identity = 24/33 (72.73%), Postives = 30/33 (90.91%), Query Frame = 2
BLAST of WMU11749 vs. NCBI nr
Match: gi|747102741|ref|XP_011099542.1| (PREDICTED: delta(7)-sterol-C5(6)-desaturase [Sesamum indicum]) HSP 1 Score: 65.1 bits (157), Expect = 8.2e-08 Identity = 24/33 (72.73%), Postives = 30/33 (90.91%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|