WMU11524 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GAGCCCTGTCCGATGTGCTTTGGCGCCATCCATCTTTCAAGAATTAAGAGATTGGTTTATGGAGCCGAAGCAGAAGCTGCAAATTGCAGTAGGATTTGATGATTTCATTTGCTTGATGCCATTAGGGGCACTGGGGTTTTATCAGAAAGCTCATTTGGAAATCAAGAAAGCAGATGGGGAATGGTGCTGTCATTGCTGAGCAAGTATTTGAGAAAACAAGGAAAAATTTCAATTGTATTGAATAATTATCCTTTTCTTTTCTTTTTTCTTTTTCTTTTTCCTTGTTAAAATAATAATATCAAATGTTCATTACATCT
BLAST of WMU11524 vs. TAIR10
Match: AT5G28050.2 (AT5G28050.2 Cytidine/deoxycytidylate deaminase family protein) HSP 1 Score: 67.8 bits (164), Expect = 4.6e-12 Identity = 35/51 (68.63%), Postives = 38/51 (74.51%), Query Frame = 1
HSP 2 Score: 40.8 bits (94), Expect = 6.0e-04 Identity = 22/37 (59.46%), Postives = 23/37 (62.16%), Query Frame = 2
BLAST of WMU11524 vs. TAIR10
Match: AT3G05300.1 (AT3G05300.1 Cytidine/deoxycytidylate deaminase family protein) HSP 1 Score: 57.0 bits (136), Expect = 8.1e-09 Identity = 31/54 (57.41%), Postives = 34/54 (62.96%), Query Frame = 1
BLAST of WMU11524 vs. TrEMBL
Match: R0FH35_9BRAS (Uncharacterized protein (Fragment) OS=Capsella rubella GN=CARUB_v10001660mg PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 9.1e-09 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. TrEMBL
Match: R0FH35_9BRAS (Uncharacterized protein (Fragment) OS=Capsella rubella GN=CARUB_v10001660mg PE=4 SV=1) HSP 1 Score: 37.7 bits (86), Expect = 1.0e+01 Identity = 21/37 (56.76%), Postives = 24/37 (64.86%), Query Frame = 2
HSP 2 Score: 67.8 bits (164), Expect = 9.1e-09 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. TrEMBL
Match: F4K5T6_ARATH (Cytidine/deoxycytidylate deaminase family protein OS=Arabidopsis thaliana GN=At5g28050 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 1.2e+00 Identity = 22/37 (59.46%), Postives = 25/37 (67.57%), Query Frame = 2
HSP 2 Score: 67.8 bits (164), Expect = 9.1e-09 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. TrEMBL
Match: D7M6T1_ARALL (Cytidine/deoxycytidylate deaminase family protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_489639 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 1.2e+00 Identity = 22/37 (59.46%), Postives = 25/37 (67.57%), Query Frame = 2
HSP 2 Score: 67.8 bits (164), Expect = 9.1e-09 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. TrEMBL
Match: Q94BU8_ARATH (AT5g28050/F15F15_120 OS=Arabidopsis thaliana GN=At5g28050 PE=2 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 1.2e+00 Identity = 22/37 (59.46%), Postives = 25/37 (67.57%), Query Frame = 2
HSP 2 Score: 67.4 bits (163), Expect = 1.2e-08 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. NCBI nr
Match: gi|727565602|ref|XP_010455164.1| (PREDICTED: tRNA(adenine(34)) deaminase, chloroplastic-like [Camelina sativa]) HSP 1 Score: 72.4 bits (176), Expect = 5.3e-10 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. NCBI nr
Match: gi|79328917|ref|NP_001031959.1| (Cytidine/deoxycytidylate deaminase family protein [Arabidopsis thaliana]) HSP 1 Score: 72.0 bits (175), Expect = 6.9e-10 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. NCBI nr
Match: gi|727646752|ref|XP_010494074.1| (PREDICTED: tRNA(adenine(34)) deaminase, chloroplastic-like isoform X1 [Camelina sativa]) HSP 1 Score: 72.0 bits (175), Expect = 6.9e-10 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. NCBI nr
Match: gi|565460808|ref|XP_006288403.1| (hypothetical protein CARUB_v10001660mg, partial [Capsella rubella]) HSP 1 Score: 72.0 bits (175), Expect = 6.9e-10 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
BLAST of WMU11524 vs. NCBI nr
Match: gi|727491236|ref|XP_010421673.1| (PREDICTED: tRNA(adenine(34)) deaminase, chloroplastic-like [Camelina sativa]) HSP 1 Score: 72.0 bits (175), Expect = 6.9e-10 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|