WMU07854 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGTTATGAAGAAGTAAGCATGTGTTAGCCAAAGATTTGTCATGTTATCTCATAAAATAAGGATGTATGCCTCGCAACCAAGAACCCGATCGTGGGTAACCTCATTTACGACGGCATCACTTGCATAATACCAAACAGAAGCATCTTCCTCAGCTTCCCCACTTGTCTCCTCCTTCCTTCGTTTGTCCCCCCTCCCCTTCCTACCGTAACGT
BLAST of WMU07854 vs. TrEMBL
Match: A0A0A0L9E4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G130860 PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.2e-09 Identity = 33/38 (86.84%), Postives = 36/38 (94.74%), Query Frame = -2
BLAST of WMU07854 vs. NCBI nr
Match: gi|659075844|ref|XP_008438362.1| (PREDICTED: ubiquitin carboxyl-terminal hydrolase 2 [Cucumis melo]) HSP 1 Score: 71.6 bits (174), Expect = 6.0e-10 Identity = 34/38 (89.47%), Postives = 36/38 (94.74%), Query Frame = -2
BLAST of WMU07854 vs. NCBI nr
Match: gi|449433181|ref|XP_004134376.1| (PREDICTED: ubiquitin carboxyl-terminal hydrolase 2 [Cucumis sativus]) HSP 1 Score: 69.7 bits (169), Expect = 2.3e-09 Identity = 33/38 (86.84%), Postives = 36/38 (94.74%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|