WMU06938 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TCCACATTCATGTTCTCCCAAGGAAGGGTGGTTGATTTTGAGAAAAATGATTGAGATTTATGATGCTATTGATGAGAAGGAGAAAGAATTGAAGCAACATCTTGATTTAGACAAGGAGAGGAAAGATAGAGACATGGAGGAGATGGCTGAAGAAGGACAGAATCAGTACAGAAAACTTTTGTTGTAACTCCCATTTCCTTTTCTTTCTGGCTTCTGCTAAGCCCCGTATTTTGAACAATTGGGTTGTAATTTATAACATAAAGTATTGAAAAATTACCTTATCATATGAAAGGCATAGTGGGGATTTTTTTTTACT
BLAST of WMU06938 vs. TAIR10
Match: AT5G58240.1 (AT5G58240.1 FRAGILE HISTIDINE TRIAD) HSP 1 Score: 59.7 bits (143), Expect = 1.3e-09 Identity = 29/40 (72.50%), Postives = 33/40 (82.50%), Query Frame = 2
BLAST of WMU06938 vs. Swiss-Prot
Match: FHIT_ARATH (Bifunctional bis(5'-adenosyl)-triphosphatase/adenylylsulfatase FHIT OS=Arabidopsis thaliana GN=FHIT PE=1 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.2e-08 Identity = 29/40 (72.50%), Postives = 33/40 (82.50%), Query Frame = 2
BLAST of WMU06938 vs. TrEMBL
Match: A0A0A0L1M8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G002820 PE=4 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 2.2e-10 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 2
BLAST of WMU06938 vs. TrEMBL
Match: E5RDD1_CUCME (Bis(5'-adenosyl)-triphosphatase OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 2.2e-10 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 2
BLAST of WMU06938 vs. TrEMBL
Match: A0A068U678_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00016543001 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.6e-08 Identity = 34/41 (82.93%), Postives = 36/41 (87.80%), Query Frame = 2
BLAST of WMU06938 vs. TrEMBL
Match: A0A151R882_CAJCA (Bis(5'-adenosyl)-triphosphatase OS=Cajanus cajan GN=KK1_039961 PE=4 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.0e-07 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = 2
BLAST of WMU06938 vs. TrEMBL
Match: C6SWJ6_SOYBN (Putative uncharacterized protein OS=Glycine max PE=2 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.0e-07 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = 2
BLAST of WMU06938 vs. NCBI nr
Match: gi|700200530|gb|KGN55663.1| (hypothetical protein Csa_3G002820 [Cucumis sativus]) HSP 1 Score: 66.6 bits (161), Expect = 2.9e-08 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 2
BLAST of WMU06938 vs. NCBI nr
Match: gi|307136091|gb|ADN33939.1| (bis(5'-adenosyl)-triphosphatase [Cucumis melo subsp. melo]) HSP 1 Score: 66.6 bits (161), Expect = 2.9e-08 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 2
BLAST of WMU06938 vs. NCBI nr
Match: gi|778674774|ref|XP_011650291.1| (PREDICTED: bis(5'-adenosyl)-triphosphatase isoform X1 [Cucumis sativus]) HSP 1 Score: 66.6 bits (161), Expect = 2.9e-08 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 2
BLAST of WMU06938 vs. NCBI nr
Match: gi|659095388|ref|XP_008448553.1| (PREDICTED: bis(5'-adenosyl)-triphosphatase-like [Cucumis melo]) HSP 1 Score: 66.6 bits (161), Expect = 2.9e-08 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 2
BLAST of WMU06938 vs. NCBI nr
Match: gi|778674779|ref|XP_011650292.1| (PREDICTED: bis(5'-adenosyl)-triphosphatase isoform X2 [Cucumis sativus]) HSP 1 Score: 66.6 bits (161), Expect = 2.9e-08 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|