WMU05303 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGGAACAAGCCAGCGGAGTCCGACTGAGGCAGTTCTTATTGTTTTCATCCTACAAGTCTAGAACCAAAAATTACCCTCTATTCTCTCAATCTTCAGTTGGTTCACTCCGTTGATTCTTCATCCGTCAAGGAATCAAAGACGAAGAATGGGGGATTGACGGATACTGTGCTGCTCAATCCCTCTGCTGAGACAGTCTATCATATTCCCCAAGTTGAAAAATCAAAAGTGCTCGGCATTCCAAATTGGGGAGAAGTAGATGGGGGAATTTATTCGTCAAGAAGCCCAAAGTCACCGATGTTGATAAAGCGATTCTGTCTCTCAAGACCCAAAGACGCAAACTCGGTCAATATCAACAACAGCTTGATGCCGTCATTGAAGCAAGAAAAGATGCTGCAAGAGAGTTTAGTTCG
BLAST of WMU05303 vs. TAIR10
Match: AT5G09260.1 (AT5G09260.1 vacuolar protein sorting-associated protein 20.2) HSP 1 Score: 81.3 bits (199), Expect = 5.2e-16 Identity = 39/47 (82.98%), Postives = 42/47 (89.36%), Query Frame = 3
BLAST of WMU05303 vs. TAIR10
Match: AT5G63880.2 (AT5G63880.2 SNF7 family protein) HSP 1 Score: 78.2 bits (191), Expect = 4.4e-15 Identity = 37/47 (78.72%), Postives = 42/47 (89.36%), Query Frame = 3
BLAST of WMU05303 vs. Swiss-Prot
Match: VP202_ARATH (Vacuolar protein sorting-associated protein 20 homolog 2 OS=Arabidopsis thaliana GN=VPS20.2 PE=1 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 9.2e-15 Identity = 39/47 (82.98%), Postives = 42/47 (89.36%), Query Frame = 3
BLAST of WMU05303 vs. Swiss-Prot
Match: VP201_ARATH (Vacuolar protein sorting-associated protein 20 homolog 1 OS=Arabidopsis thaliana GN=VPS20.1 PE=1 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 7.8e-14 Identity = 37/47 (78.72%), Postives = 42/47 (89.36%), Query Frame = 3
BLAST of WMU05303 vs. TrEMBL
Match: V4T722_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10002389mg PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.6e-13 Identity = 41/47 (87.23%), Postives = 44/47 (93.62%), Query Frame = 3
BLAST of WMU05303 vs. TrEMBL
Match: A0A059B8R7_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H05139 PE=3 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 2.1e-13 Identity = 42/47 (89.36%), Postives = 44/47 (93.62%), Query Frame = 3
BLAST of WMU05303 vs. TrEMBL
Match: D7STC3_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_12s0055g00780 PE=3 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.7e-13 Identity = 40/47 (85.11%), Postives = 44/47 (93.62%), Query Frame = 3
BLAST of WMU05303 vs. TrEMBL
Match: C6T3K6_SOYBN (Putative uncharacterized protein (Fragment) OS=Glycine max PE=2 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.5e-13 Identity = 41/47 (87.23%), Postives = 44/47 (93.62%), Query Frame = 3
BLAST of WMU05303 vs. TrEMBL
Match: C6TE32_SOYBN (Putative uncharacterized protein OS=Glycine max PE=2 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.5e-13 Identity = 41/47 (87.23%), Postives = 44/47 (93.62%), Query Frame = 3
BLAST of WMU05303 vs. NCBI nr
Match: gi|659083085|ref|XP_008442177.1| (PREDICTED: vacuolar protein sorting-associated protein 20 homolog 2-like [Cucumis melo]) HSP 1 Score: 87.8 bits (216), Expect = 1.6e-14 Identity = 45/47 (95.74%), Postives = 46/47 (97.87%), Query Frame = 3
BLAST of WMU05303 vs. NCBI nr
Match: gi|778695034|ref|XP_011653914.1| (PREDICTED: vacuolar protein sorting-associated protein 20 homolog 2 [Cucumis sativus]) HSP 1 Score: 87.0 bits (214), Expect = 2.7e-14 Identity = 44/47 (93.62%), Postives = 46/47 (97.87%), Query Frame = 3
BLAST of WMU05303 vs. NCBI nr
Match: gi|567879115|ref|XP_006432116.1| (hypothetical protein CICLE_v10002389mg [Citrus clementina]) HSP 1 Score: 82.4 bits (202), Expect = 6.6e-13 Identity = 41/47 (87.23%), Postives = 44/47 (93.62%), Query Frame = 3
BLAST of WMU05303 vs. NCBI nr
Match: gi|702451725|ref|XP_010025761.1| (PREDICTED: vacuolar protein sorting-associated protein 20 homolog 2 [Eucalyptus grandis]) HSP 1 Score: 82.0 bits (201), Expect = 8.7e-13 Identity = 42/47 (89.36%), Postives = 44/47 (93.62%), Query Frame = 3
BLAST of WMU05303 vs. NCBI nr
Match: gi|225447834|ref|XP_002270590.1| (PREDICTED: vacuolar protein sorting-associated protein 20 homolog 2 [Vitis vinifera]) HSP 1 Score: 81.6 bits (200), Expect = 1.1e-12 Identity = 40/47 (85.11%), Postives = 44/47 (93.62%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|