WMU04921 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ACTCAAGGAAAAGCATTGAACGCTGTAGGCAAAACTGAACTTCGTCAGGATATGAGGGATGCATTGATAGGGATTGTACCGGTGGAGACGGCGGAGGAATGCGCGAAGGCGGTGGTGAGAGGAGTATGCAGGGGACACAGGTACGTGACGGAGCCGTCGTGGTATAATGTGCTTTATTACTGGAAGGCGTTTTTGTCCGGAGGTGGTTGAGTGGTGCTACCGGATAATGGCTATGCCGGCGCCTGGAGCTTCTGAATCCGACGCCCTCAGCAAGTACGCCCTGGACTTTACCGGTGGCAAGTATCTCCTGTATCCTTCTTCCATTCGCTCAACCGAGCTGAAGGCCGATTAAATCCACCATCATATTTATCAACCCCTTTTCTATTTTGTATGTGTGTGCTACTTCTTTGTAGAATCTCTCACCTTCTTACTTCCATATATTCAACTTTGTTTTATCTATAATTTTCTATTGGCTTATGCGTTATCAAATAAATATTATGATTTCATGTTTAACCGT
BLAST of WMU04921 vs. TAIR10
Match: AT5G50600.1 (AT5G50600.1 hydroxysteroid dehydrogenase 1) HSP 1 Score: 77.4 bits (189), Expect = 9.5e-15 Identity = 34/62 (54.84%), Postives = 40/62 (64.52%), Query Frame = 1
HSP 2 Score: 54.3 bits (129), Expect = 8.6e-08 Identity = 24/52 (46.15%), Postives = 32/52 (61.54%), Query Frame = 2
BLAST of WMU04921 vs. TAIR10
Match: AT5G50700.1 (AT5G50700.1 hydroxysteroid dehydrogenase 1) HSP 1 Score: 77.4 bits (189), Expect = 9.5e-15 Identity = 34/62 (54.84%), Postives = 40/62 (64.52%), Query Frame = 1
HSP 2 Score: 54.3 bits (129), Expect = 8.6e-08 Identity = 24/52 (46.15%), Postives = 32/52 (61.54%), Query Frame = 2
BLAST of WMU04921 vs. TAIR10
Match: AT5G50770.1 (AT5G50770.1 hydroxysteroid dehydrogenase 6) HSP 1 Score: 65.9 bits (159), Expect = 2.9e-11 Identity = 28/66 (42.42%), Postives = 41/66 (62.12%), Query Frame = 1
BLAST of WMU04921 vs. TAIR10
Match: AT5G50590.1 (AT5G50590.1 hydroxysteroid dehydrogenase 4) HSP 1 Score: 53.9 bits (128), Expect = 1.1e-07 Identity = 22/39 (56.41%), Postives = 27/39 (69.23%), Query Frame = 1
BLAST of WMU04921 vs. TAIR10
Match: AT5G50690.1 (AT5G50690.1 hydroxysteroid dehydrogenase 7) HSP 1 Score: 53.9 bits (128), Expect = 1.1e-07 Identity = 22/39 (56.41%), Postives = 27/39 (69.23%), Query Frame = 1
BLAST of WMU04921 vs. Swiss-Prot
Match: HSD1A_ARATH (11-beta-hydroxysteroid dehydrogenase 1A OS=Arabidopsis thaliana GN=HSD1 PE=1 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 1.7e-13 Identity = 34/62 (54.84%), Postives = 40/62 (64.52%), Query Frame = 1
HSP 2 Score: 54.3 bits (129), Expect = 1.5e-06 Identity = 24/52 (46.15%), Postives = 32/52 (61.54%), Query Frame = 2
BLAST of WMU04921 vs. Swiss-Prot
Match: HSD1B_ARATH (11-beta-hydroxysteroid dehydrogenase 1B OS=Arabidopsis thaliana GN=HSD1 PE=1 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 1.7e-13 Identity = 34/62 (54.84%), Postives = 40/62 (64.52%), Query Frame = 1
HSP 2 Score: 54.3 bits (129), Expect = 1.5e-06 Identity = 24/52 (46.15%), Postives = 32/52 (61.54%), Query Frame = 2
BLAST of WMU04921 vs. Swiss-Prot
Match: HSD6_ARATH (11-beta-hydroxysteroid dehydrogenase-like 6 OS=Arabidopsis thaliana GN=HSD6 PE=2 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 5.1e-10 Identity = 28/66 (42.42%), Postives = 41/66 (62.12%), Query Frame = 1
BLAST of WMU04921 vs. Swiss-Prot
Match: HSD4A_ARATH (11-beta-hydroxysteroid dehydrogenase-like 4A OS=Arabidopsis thaliana GN=HSD4 PE=2 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 2.0e-06 Identity = 22/39 (56.41%), Postives = 27/39 (69.23%), Query Frame = 1
BLAST of WMU04921 vs. Swiss-Prot
Match: HSD4B_ARATH (11-beta-hydroxysteroid dehydrogenase-like 4B OS=Arabidopsis thaliana GN=HSD7 PE=2 SV=2) HSP 1 Score: 53.9 bits (128), Expect = 2.0e-06 Identity = 22/39 (56.41%), Postives = 27/39 (69.23%), Query Frame = 1
BLAST of WMU04921 vs. TrEMBL
Match: A0A0A0LRM4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G051660 PE=3 SV=1) HSP 1 Score: 124.0 bits (310), Expect = 1.8e-25 Identity = 57/64 (89.06%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of WMU04921 vs. TrEMBL
Match: A0A0A0LRM4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G051660 PE=3 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 4.2e-19 Identity = 45/55 (81.82%), Postives = 51/55 (92.73%), Query Frame = 2
HSP 2 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 43/64 (67.19%), Postives = 51/64 (79.69%), Query Frame = 1
BLAST of WMU04921 vs. TrEMBL
Match: A0A0A0LUG2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G051650 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 9.6e-08 Identity = 29/53 (54.72%), Postives = 37/53 (69.81%), Query Frame = 2
HSP 2 Score: 82.8 bits (203), Expect = 4.5e-13 Identity = 35/64 (54.69%), Postives = 44/64 (68.75%), Query Frame = 1
BLAST of WMU04921 vs. TrEMBL
Match: M1DQB9_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400042259 PE=4 SV=1) HSP 1 Score: 49.7 bits (117), Expect = 4.2e-03 Identity = 23/45 (51.11%), Postives = 31/45 (68.89%), Query Frame = 2
HSP 2 Score: 81.6 bits (200), Expect = 1.0e-12 Identity = 35/62 (56.45%), Postives = 44/62 (70.97%), Query Frame = 1
BLAST of WMU04921 vs. TrEMBL
Match: V4VCM4_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10031927mg PE=3 SV=1) HSP 1 Score: 45.8 bits (107), Expect = 6.1e-02 Identity = 22/50 (44.00%), Postives = 29/50 (58.00%), Query Frame = 2
HSP 2 Score: 81.6 bits (200), Expect = 1.0e-12 Identity = 33/64 (51.56%), Postives = 42/64 (65.62%), Query Frame = 1
BLAST of WMU04921 vs. NCBI nr
Match: gi|659068791|ref|XP_008446259.1| (PREDICTED: 11-beta-hydroxysteroid dehydrogenase 1B-like [Cucumis melo]) HSP 1 Score: 127.5 bits (319), Expect = 2.3e-26 Identity = 59/64 (92.19%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of WMU04921 vs. NCBI nr
Match: gi|449454957|ref|XP_004145220.1| (PREDICTED: 11-beta-hydroxysteroid dehydrogenase 1B-like [Cucumis sativus]) HSP 1 Score: 124.8 bits (312), Expect = 1.5e-25 Identity = 57/64 (89.06%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of WMU04921 vs. NCBI nr
Match: gi|659067540|ref|XP_008439964.1| (PREDICTED: 11-beta-hydroxysteroid dehydrogenase 1B-like [Cucumis melo]) HSP 1 Score: 96.7 bits (239), Expect = 4.3e-17 Identity = 43/64 (67.19%), Postives = 51/64 (79.69%), Query Frame = 1
BLAST of WMU04921 vs. NCBI nr
Match: gi|700209331|gb|KGN64427.1| (hypothetical protein Csa_1G051650 [Cucumis sativus]) HSP 1 Score: 96.3 bits (238), Expect = 5.6e-17 Identity = 43/64 (67.19%), Postives = 51/64 (79.69%), Query Frame = 1
BLAST of WMU04921 vs. NCBI nr
Match: gi|449470838|ref|XP_004153123.1| (PREDICTED: 11-beta-hydroxysteroid dehydrogenase 1B-like [Cucumis sativus]) HSP 1 Score: 96.3 bits (238), Expect = 5.6e-17 Identity = 43/64 (67.19%), Postives = 51/64 (79.69%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|