MU67013 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ATCCTCCTCCTACCGGTCGTAATTTCAGTTACGAGCATCGCCATCCCCGCCGCCCCCGTCCCCAACCTGTCCACAAACCGGAGGTCACTTCTCTGGCCGATGGAATAGAATCTTTCACTTTCGACGAAAAGCCTGTGGACTTCGATGTTGCGAAACCTAACTGTGAGGTTAAACAACAGACACCTGGAAATTCTTCCTCAGCTGAGGCTGCGGATGATGTTTATAGTAGGTTAGAGATGCTGCAGCGGAGTTCCGAGGAGCCGGTGTTGTCGGAGGAGCAGCTCAGTATTAATGATCAGTTGCAGGAAGATGAGTTGCTGGCTTTGGAGTCCATATATGGAGAAAATGTCTATA
BLAST of MU67013 vs. NCBI nr
Match: gi|659132069|ref|XP_008466000.1| (PREDICTED: E3 ubiquitin-protein ligase RNF14 [Cucumis melo]) HSP 1 Score: 181.0 bits (458), Expect = 1.2e-42 Identity = 94/117 (80.34%), Postives = 94/117 (80.34%), Query Frame = 3
BLAST of MU67013 vs. NCBI nr
Match: gi|449436832|ref|XP_004136196.1| (PREDICTED: E3 ubiquitin-protein ligase RNF14 [Cucumis sativus]) HSP 1 Score: 152.1 bits (383), Expect = 5.9e-34 Identity = 81/117 (69.23%), Postives = 85/117 (72.65%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|