MU67001 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CCCTTCAATCCACCGCCATAAATGAAGCTCTGCAATGCAGCGTAAGCTCATCCGACCCCTTTTCCCATGGCTCATCCTTCTTCCCCTCTTAATCTTTTTTCTCTACTCCTTAACCGTGTCTCTTCACGCACCCATTTCGCCATCTCCAAAAATCAAAAAGATTTCTGCATCACCCACATGCAATCTCTTCAAGGGTCACTGGAGTCGAGACCCCAATCGCAGGCCCATTTACGATGAGACTTGCCCATTTCATAGAAACGCCTGGAATTGCTTTAGGAACCAAAGAGAGAATATGGGTACAATCAAT
BLAST of MU67001 vs. Swiss-Prot
Match: TBL12_ARATH (Protein trichome birefringence-like 12 OS=Arabidopsis thaliana GN=TBL12 PE=2 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.2e-11 Identity = 28/44 (63.64%), Postives = 32/44 (72.73%), Query Frame = 2
BLAST of MU67001 vs. TrEMBL
Match: A0A0A0K2T1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G068610 PE=4 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 2.2e-20 Identity = 46/68 (67.65%), Postives = 50/68 (73.53%), Query Frame = 2
BLAST of MU67001 vs. TrEMBL
Match: M5VJ38_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa006682mg PE=4 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 1.2e-16 Identity = 36/44 (81.82%), Postives = 41/44 (93.18%), Query Frame = 2
BLAST of MU67001 vs. TrEMBL
Match: M0ZU09_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400003117 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.7e-16 Identity = 37/44 (84.09%), Postives = 39/44 (88.64%), Query Frame = 2
BLAST of MU67001 vs. TrEMBL
Match: M0ZU12_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400003117 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.7e-16 Identity = 37/44 (84.09%), Postives = 39/44 (88.64%), Query Frame = 2
BLAST of MU67001 vs. TrEMBL
Match: M0ZU10_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400003117 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.7e-16 Identity = 37/44 (84.09%), Postives = 39/44 (88.64%), Query Frame = 2
BLAST of MU67001 vs. TAIR10
Match: AT5G64470.2 (AT5G64470.2 Plant protein of unknown function (DUF828)) HSP 1 Score: 70.5 bits (171), Expect = 6.9e-13 Identity = 28/44 (63.64%), Postives = 32/44 (72.73%), Query Frame = 2
BLAST of MU67001 vs. NCBI nr
Match: gi|659110192|ref|XP_008455098.1| (PREDICTED: protein trichome birefringence-like 12 [Cucumis melo]) HSP 1 Score: 118.2 bits (295), Expect = 8.2e-24 Identity = 56/91 (61.54%), Postives = 56/91 (61.54%), Query Frame = 2
BLAST of MU67001 vs. NCBI nr
Match: gi|449438268|ref|XP_004136911.1| (PREDICTED: protein trichome birefringence-like 12 [Cucumis sativus]) HSP 1 Score: 107.5 bits (267), Expect = 1.4e-20 Identity = 46/68 (67.65%), Postives = 50/68 (73.53%), Query Frame = 2
BLAST of MU67001 vs. NCBI nr
Match: gi|645263070|ref|XP_008237059.1| (PREDICTED: LOW QUALITY PROTEIN: protein trichome birefringence-like 12 [Prunus mume]) HSP 1 Score: 94.7 bits (234), Expect = 9.7e-17 Identity = 36/44 (81.82%), Postives = 41/44 (93.18%), Query Frame = 2
BLAST of MU67001 vs. NCBI nr
Match: gi|595792303|ref|XP_007199900.1| (hypothetical protein PRUPE_ppa006682mg [Prunus persica]) HSP 1 Score: 94.7 bits (234), Expect = 9.7e-17 Identity = 36/44 (81.82%), Postives = 41/44 (93.18%), Query Frame = 2
BLAST of MU67001 vs. NCBI nr
Match: gi|969996994|ref|XP_015065586.1| (PREDICTED: protein trichome birefringence-like 12 [Solanum pennellii]) HSP 1 Score: 92.4 bits (228), Expect = 4.8e-16 Identity = 37/44 (84.09%), Postives = 39/44 (88.64%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|