MU66970 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CCCTTCTCCAATCCTACACAGCCATTCACCTCCACACAATCTCAAACTACCTGAAAACTAAACTGTCCTGTAACAAACAAAAAATCCAAAAATGAAATTTCGATACACGTGGTCGAAATTCAAAGCTTCTTTCATCCAATCAACTCTGTTCCCCGTTTCGGATTACTCCTTTCACTCTGTTCATCCATGGCCGCCGTTGCTGCAGCAGCAGGTGGGGTTAGTATAGGAGTGACCAACCTCCAGCTGCACCATTTGAAACAACCCACTTCGCCATTTCTCGGGAAGAAGCTCAGGTTTAAGCACAAATCGCCCTATCTTTGGACAGTATCCGTTCAGAATCCCAGAAATGTACTGGTTTCGGCTCTGGGCGGTGACCTGATACATGTGGTTCATAATCTCTTTGTGGGTGTGGGTGTGGGGCTTCCTTGTACTGTGATGGAGTGCGGTGATATCATATACAGGAGCACTTTACCCAAGTCTAATGGCTTACCCCTCACAATCCCTGGTGCCATTCTGGCTTTGGGTACTCTTTTCTTATC
BLAST of MU66970 vs. Swiss-Prot
Match: STT7_ARATH (Serine/threonine-protein kinase STN7, chloroplastic OS=Arabidopsis thaliana GN=STN7 PE=1 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 2.5e-20 Identity = 56/89 (62.92%), Postives = 59/89 (66.29%), Query Frame = 1
BLAST of MU66970 vs. TrEMBL
Match: A0A0A0L2X0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G067770 PE=3 SV=1) HSP 1 Score: 194.9 bits (494), Expect = 8.4e-47 Identity = 93/100 (93.00%), Postives = 96/100 (96.00%), Query Frame = 1
BLAST of MU66970 vs. TrEMBL
Match: M5Y1Y3_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa025555mg PE=3 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 1.4e-25 Identity = 68/103 (66.02%), Postives = 78/103 (75.73%), Query Frame = 1
BLAST of MU66970 vs. TrEMBL
Match: A0A151RU26_CAJCA (Uncharacterized protein OS=Cajanus cajan GN=KK1_032405 PE=3 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 1.7e-23 Identity = 60/102 (58.82%), Postives = 74/102 (72.55%), Query Frame = 1
BLAST of MU66970 vs. TrEMBL
Match: U5G228_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0010s13970g PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 1.4e-22 Identity = 61/101 (60.40%), Postives = 71/101 (70.30%), Query Frame = 1
BLAST of MU66970 vs. TrEMBL
Match: A0A103YA68_CYNCS (Uncharacterized protein OS=Cynara cardunculus var. scolymus GN=Ccrd_016334 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 1.4e-22 Identity = 60/103 (58.25%), Postives = 77/103 (74.76%), Query Frame = 1
BLAST of MU66970 vs. TAIR10
Match: AT1G68830.1 (AT1G68830.1 STT7 homolog STN7) HSP 1 Score: 100.1 bits (248), Expect = 1.4e-21 Identity = 56/89 (62.92%), Postives = 59/89 (66.29%), Query Frame = 1
BLAST of MU66970 vs. NCBI nr
Match: gi|659131523|ref|XP_008465727.1| (PREDICTED: serine/threonine-protein kinase STN7, chloroplastic isoform X2 [Cucumis melo]) HSP 1 Score: 204.9 bits (520), Expect = 1.2e-49 Identity = 99/100 (99.00%), Postives = 99/100 (99.00%), Query Frame = 1
BLAST of MU66970 vs. NCBI nr
Match: gi|659131521|ref|XP_008465726.1| (PREDICTED: serine/threonine-protein kinase STN7, chloroplastic isoform X1 [Cucumis melo]) HSP 1 Score: 204.9 bits (520), Expect = 1.2e-49 Identity = 99/100 (99.00%), Postives = 99/100 (99.00%), Query Frame = 1
BLAST of MU66970 vs. NCBI nr
Match: gi|449452072|ref|XP_004143784.1| (PREDICTED: serine/threonine-protein kinase STN7, chloroplastic isoform X1 [Cucumis sativus]) HSP 1 Score: 194.9 bits (494), Expect = 1.2e-46 Identity = 93/100 (93.00%), Postives = 96/100 (96.00%), Query Frame = 1
BLAST of MU66970 vs. NCBI nr
Match: gi|778675988|ref|XP_011650513.1| (PREDICTED: serine/threonine-protein kinase STN7, chloroplastic isoform X2 [Cucumis sativus]) HSP 1 Score: 194.9 bits (494), Expect = 1.2e-46 Identity = 93/100 (93.00%), Postives = 96/100 (96.00%), Query Frame = 1
BLAST of MU66970 vs. NCBI nr
Match: gi|645276190|ref|XP_008243170.1| (PREDICTED: serine/threonine-protein kinase STN7, chloroplastic [Prunus mume]) HSP 1 Score: 125.9 bits (315), Expect = 6.9e-26 Identity = 68/103 (66.02%), Postives = 78/103 (75.73%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|