MU66568 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CTCGATCGCAAGCCCCCACGTCTTCTTCTGTCGGATCGATTGCAAGCCACCGTAAGAGGTTCGTCTGTTGTCGTCGCTGAAGACATTGTGTTTGTCCGTCACTGAAGATTTGGTGTGTTCGTCCGCCATCATTTAAAACAGGTTCATCCGCAACAGTTCATCTGCCGCTGCAACAGTTCGTCTATTGCCGCAACAGGTTCTTCCGTCACAATAGGTTCGTCCCCCGCAACAGTAATGAAAGAAATTAGTAGTAGTAGCGGTGGAAGCAACGAACGACGATGGCAACCATTGGCACTTCGATTTGCTAGCAGCTATGAGGACACTTGAGGGTGGGTTCAATGCTAGGGCTTAAAGTGATGGCTTACGATTTACCCCTCGGTCGTCAACTCGGGTTTGAATTGGATATGTTTGTAAAGTCTGTTAATGTAACATCCAAGAGGGTTGAAGACTTGTTAGGAAAAACCATGGTATATTACTACATGTTTCAAGGTTGTCGAGTAAAAATTGGAAGACTATATAGTTATTAAGTAGATTGGGAGGGGAGCATTTGAATCGACTTTTCTTGTTTATCACAAGGCTAAGAAGAAAAGAAATGAAACAAATTTTTGCTTATGGCAAAGCAAATAGAGAAGTTCAAGCGCACTGCCCACCAAGAGATCAGGTTTGTTCGAGAAATCTAGGGCAGAGACTGCTATGGCTCATAAGGTAGACCACGAGTATGACTATTTGTTCAAGATTGTTCCGATTGAGGATTCCAACATTGGGAAGTCCAACATTCTTTNCAGATTTACTAGAAACAAGTTCTACTTGG
BLAST of MU66568 vs. Swiss-Prot
Match: RB11C_LOTJA (Ras-related protein Rab11C OS=Lotus japonicus GN=RAB11C PE=2 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 4.7e-10 Identity = 31/39 (79.49%), Postives = 32/39 (82.05%), Query Frame = 1
BLAST of MU66568 vs. Swiss-Prot
Match: RB2BV_BETVU (Ras-related protein Rab2BV OS=Beta vulgaris GN=RAB2BV PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 3.0e-09 Identity = 30/39 (76.92%), Postives = 32/39 (82.05%), Query Frame = 1
BLAST of MU66568 vs. Swiss-Prot
Match: RAA2B_ARATH (Ras-related protein RABA2b OS=Arabidopsis thaliana GN=RABA2B PE=2 SV=2) HSP 1 Score: 63.5 bits (153), Expect = 4.0e-09 Identity = 29/39 (74.36%), Postives = 32/39 (82.05%), Query Frame = 1
BLAST of MU66568 vs. Swiss-Prot
Match: RB11A_TOBAC (Ras-related protein Rab11A OS=Nicotiana tabacum GN=RAB11A PE=2 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 6.8e-09 Identity = 29/39 (74.36%), Postives = 32/39 (82.05%), Query Frame = 1
BLAST of MU66568 vs. Swiss-Prot
Match: RAA2C_ARATH (Ras-related protein RABA2c OS=Arabidopsis thaliana GN=RABA2C PE=2 SV=4) HSP 1 Score: 62.0 bits (149), Expect = 1.2e-08 Identity = 29/39 (74.36%), Postives = 30/39 (76.92%), Query Frame = 1
BLAST of MU66568 vs. TrEMBL
Match: A0A0D3ECN5_BRAOL (Uncharacterized protein (Fragment) OS=Brassica oleracea var. oleracea PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 1.4e-08 Identity = 32/49 (65.31%), Postives = 40/49 (81.63%), Query Frame = 1
BLAST of MU66568 vs. TrEMBL
Match: A0A0A0KE61_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G188120 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 2.3e-08 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MU66568 vs. TrEMBL
Match: B9S3C5_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0732500 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 2.3e-08 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MU66568 vs. TrEMBL
Match: W1PX83_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00165p00060220 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 2.3e-08 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MU66568 vs. TrEMBL
Match: A0A067LDP3_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_02924 PE=4 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 5.2e-08 Identity = 31/39 (79.49%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MU66568 vs. TAIR10
Match: AT1G07410.1 (AT1G07410.1 RAB GTPase homolog A2B) HSP 1 Score: 63.5 bits (153), Expect = 2.2e-10 Identity = 29/39 (74.36%), Postives = 32/39 (82.05%), Query Frame = 1
BLAST of MU66568 vs. TAIR10
Match: AT3G46830.1 (AT3G46830.1 RAB GTPase homolog A2C) HSP 1 Score: 62.0 bits (149), Expect = 6.5e-10 Identity = 29/39 (74.36%), Postives = 30/39 (76.92%), Query Frame = 1
BLAST of MU66568 vs. TAIR10
Match: AT5G59150.1 (AT5G59150.1 RAB GTPase homolog A2D) HSP 1 Score: 59.7 bits (143), Expect = 3.2e-09 Identity = 27/39 (69.23%), Postives = 31/39 (79.49%), Query Frame = 1
BLAST of MU66568 vs. TAIR10
Match: AT1G09630.1 (AT1G09630.1 RAB GTPase 11C) HSP 1 Score: 57.0 bits (136), Expect = 2.1e-08 Identity = 26/39 (66.67%), Postives = 29/39 (74.36%), Query Frame = 1
BLAST of MU66568 vs. TAIR10
Match: AT5G60860.1 (AT5G60860.1 RAB GTPase homolog A1F) HSP 1 Score: 56.2 bits (134), Expect = 3.6e-08 Identity = 25/38 (65.79%), Postives = 29/38 (76.32%), Query Frame = 1
BLAST of MU66568 vs. NCBI nr
Match: gi|659094566|ref|XP_008448132.1| (PREDICTED: ras-related protein Rab11C-like [Cucumis melo]) HSP 1 Score: 97.8 bits (242), Expect = 3.0e-17 Identity = 50/75 (66.67%), Postives = 55/75 (73.33%), Query Frame = 1
BLAST of MU66568 vs. NCBI nr
Match: gi|659123617|ref|XP_008461753.1| (PREDICTED: ras-related protein Rab11C-like isoform X1 [Cucumis melo]) HSP 1 Score: 95.5 bits (236), Expect = 1.5e-16 Identity = 51/74 (68.92%), Postives = 56/74 (75.68%), Query Frame = 1
BLAST of MU66568 vs. NCBI nr
Match: gi|659123623|ref|XP_008461756.1| (PREDICTED: ras-related protein Rab11C-like isoform X2 [Cucumis melo]) HSP 1 Score: 95.5 bits (236), Expect = 1.5e-16 Identity = 51/74 (68.92%), Postives = 56/74 (75.68%), Query Frame = 1
BLAST of MU66568 vs. NCBI nr
Match: gi|1009114793|ref|XP_015873880.1| (PREDICTED: ras-related protein Rab2BV [Ziziphus jujuba]) HSP 1 Score: 68.6 bits (166), Expect = 2.0e-08 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MU66568 vs. NCBI nr
Match: gi|449450768|ref|XP_004143134.1| (PREDICTED: ras-related protein Rab11C [Cucumis sativus]) HSP 1 Score: 68.6 bits (166), Expect = 2.0e-08 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|