MU66002 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AACCCACAAACCAAAACATTAAAACTTATTTTTTTTTGAAGAACAAACCATAAAACAACGACATACAAAACCTTCCAAAACCCCAACTAACTAAACAAAGTTACATAACATCCCGACCTTCATCAGTTCGGGGCCTTCTTGGATTAACCCCCCTACAATTCAATCTAATCTCTCCTTTGTTCCCAGTTAAA
BLAST of MU66002 vs. NCBI nr
Match: gi|659097709|ref|XP_008449771.1| (PREDICTED: peroxidase 2-like [Cucumis melo]) HSP 1 Score: 63.5 bits (153), Expect = 1.5e-07 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|