MU66001 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ATGTTACAAGTCTCAATTTTTATAATTCGTTTTAGAGAACCCAATTCATCTTTCTCTTCGCTTTCATTCTGATCAACGATTCAACATACAACAACCGCCTCAGTTTCTTTCTCATTCATTCAAATTCGTCGACCCGTCTTCCCATTAATTTGGGTCCTCCAGCTACCAAAAAGTCATACACAGGAAGATATGGTGGGCTTGAAGCCGAATTTGCCCTCTTGGACGAGTTTCTCATCGACCCGGGTTGATGTTGAGAGAAATGTTTCTTCTTTATCGGATTCCATCTTCAGAGACGGCGAAGAAGGCCCATCGGAGCAGTCTCGCCGCCTCTCTGATGCCAATTTGAGCTTTGGAGAACGATCCCTTTCCGCCGCTGGAGCCGCCGTTCTTTCTGCCATTCTCGTTAATCCCCTTGACGTTGCCAAGGAATGTTAAATTTCTATGAATTTATAATTGGGATTTTGCCATTTCTTAGTTTCTTTCATTTTCTTTAGAGTACGGTAGTTTCAATTACTAACATCTTTAGTTTCTTCGAAGTGTTGCATATTTGTGAGTACCTTTGAGTTGATTGTTTGCTTTGATTATGTGTCTTCAGACAAGGTTGCAAGCACAAGCTGCTGGAGTCCCATATCAAGGGCCATGCC
BLAST of MU66001 vs. TrEMBL
Match: E5GCG5_CUCME (Mitochondrial carrier protein OS=Cucumis melo subsp. melo PE=3 SV=1) HSP 1 Score: 127.5 bits (319), Expect = 2.0e-26 Identity = 66/80 (82.50%), Postives = 66/80 (82.50%), Query Frame = 1
BLAST of MU66001 vs. TrEMBL
Match: E5GCG5_CUCME (Mitochondrial carrier protein OS=Cucumis melo subsp. melo PE=3 SV=1) HSP 1 Score: 36.2 bits (82), Expect = 6.0e+01 Identity = 17/26 (65.38%), Postives = 18/26 (69.23%), Query Frame = 1
HSP 2 Score: 117.5 bits (293), Expect = 2.0e-23 Identity = 61/79 (77.22%), Postives = 61/79 (77.22%), Query Frame = 1
BLAST of MU66001 vs. TrEMBL
Match: A0A0A0L8P7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G120400 PE=3 SV=1) HSP 1 Score: 35.4 bits (80), Expect = 1.0e+02 Identity = 15/17 (88.24%), Postives = 16/17 (94.12%), Query Frame = 2
HSP 2 Score: 75.9 bits (185), Expect = 6.8e-11 Identity = 39/82 (47.56%), Postives = 52/82 (63.41%), Query Frame = 1
BLAST of MU66001 vs. TrEMBL
Match: A5BTA8_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_014580 PE=3 SV=1) HSP 1 Score: 29.6 bits (65), Expect = 5.6e+03 Identity = 13/17 (76.47%), Postives = 14/17 (82.35%), Query Frame = 2
HSP 2 Score: 75.9 bits (185), Expect = 6.8e-11 Identity = 39/82 (47.56%), Postives = 52/82 (63.41%), Query Frame = 1
BLAST of MU66001 vs. TrEMBL
Match: F6I6A1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_15s0046g01370 PE=3 SV=1) HSP 1 Score: 29.6 bits (65), Expect = 5.6e+03 Identity = 13/17 (76.47%), Postives = 14/17 (82.35%), Query Frame = 2
HSP 2 Score: 61.6 bits (148), Expect = 1.3e-06 Identity = 33/83 (39.76%), Postives = 46/83 (55.42%), Query Frame = 1
BLAST of MU66001 vs. NCBI nr
Match: gi|307136350|gb|ADN34164.1| (mitochondrial carrier protein [Cucumis melo subsp. melo]) HSP 1 Score: 127.1 bits (318), Expect = 3.7e-26 Identity = 66/80 (82.50%), Postives = 66/80 (82.50%), Query Frame = 1
BLAST of MU66001 vs. NCBI nr
Match: gi|659075089|ref|XP_008437959.1| (PREDICTED: mitochondrial carrier protein MTM1 isoform X1 [Cucumis melo]) HSP 1 Score: 124.8 bits (312), Expect = 1.8e-25 Identity = 65/79 (82.28%), Postives = 65/79 (82.28%), Query Frame = 1
BLAST of MU66001 vs. NCBI nr
Match: gi|778677041|ref|XP_011650718.1| (PREDICTED: mitochondrial carrier protein MTM1 isoform X1 [Cucumis sativus]) HSP 1 Score: 116.7 bits (291), Expect = 5.0e-23 Identity = 61/79 (77.22%), Postives = 61/79 (77.22%), Query Frame = 1
BLAST of MU66001 vs. NCBI nr
Match: gi|147812722|emb|CAN61750.1| (hypothetical protein VITISV_014580 [Vitis vinifera]) HSP 1 Score: 75.1 bits (183), Expect = 1.7e-10 Identity = 39/82 (47.56%), Postives = 52/82 (63.41%), Query Frame = 1
BLAST of MU66001 vs. NCBI nr
Match: gi|731421807|ref|XP_010661879.1| (PREDICTED: mitochondrial carrier protein MTM1 isoform X1 [Vitis vinifera]) HSP 1 Score: 75.1 bits (183), Expect = 1.7e-10 Identity = 39/82 (47.56%), Postives = 52/82 (63.41%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|