MU65992 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AGAGGTTGTTGATTCATTACTCCATGTTCTTCCTTTGAATTTTCTCATGAATTAATGGGTTTCTGTTACTTTCTGCTTCGAATTTTGGTTGAACTTTGAATGTTCCTTGCAATTGATTTAAATGAAAAATGGGTTTGTGATTCATCTTCCATTTTAGGATTCTGGCGAATAGACAATCTGCTGCACGATCCAAGGAGAGAAAAATACGTTACACTAATGGGTGATGCTGCCAACTTACTGAGTTAGTGTATGATGGTGTTTTTGATGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGAGCATAACGACCAAAGCACCGCCCGACATCAGCGCTATCTCTGCTC
BLAST of MU65992 vs. TrEMBL
Match: A0A0K3Z9C7_ECOLX (Xanthine dehydrogenase subunit XdhA OS=Escherichia coli GN=ndhL PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 2.0e-15 Identity = 42/47 (89.36%), Postives = 45/47 (95.74%), Query Frame = 3
BLAST of MU65992 vs. TrEMBL
Match: A0A075MDM4_ECOLX (Mobile element protein OS=Escherichia coli PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.4e-13 Identity = 38/42 (90.48%), Postives = 41/42 (97.62%), Query Frame = 3
BLAST of MU65992 vs. TrEMBL
Match: A0A0H2XJD1_ECOK1 (InsA OS=Escherichia coli O1:K1 / APEC GN=insA PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.4e-13 Identity = 38/42 (90.48%), Postives = 41/42 (97.62%), Query Frame = 3
BLAST of MU65992 vs. TrEMBL
Match: Q1R4C9_ECOUT (Uncharacterized protein OS=Escherichia coli (strain UTI89 / UPEC) GN=UTI89_C4368 PE=4 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.4e-13 Identity = 38/42 (90.48%), Postives = 41/42 (97.62%), Query Frame = 3
BLAST of MU65992 vs. TrEMBL
Match: D1JAB1_9ARCH (Putative uncharacterized protein OS=uncultured archaeon GN=BSM_25190 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 9.3e-13 Identity = 37/42 (88.10%), Postives = 40/42 (95.24%), Query Frame = 3
BLAST of MU65992 vs. NCBI nr
Match: gi|652021062|gb|KDX40130.1| (adhesin-like autotransporter domain protein [Escherichia coli 2-156-04_S4_C3]) HSP 1 Score: 99.8 bits (247), Expect = 3.6e-18 Identity = 47/63 (74.60%), Postives = 53/63 (84.13%), Query Frame = 3
BLAST of MU65992 vs. NCBI nr
Match: gi|692979933|ref|WP_032170113.1| (hypothetical protein [Escherichia coli]) HSP 1 Score: 99.8 bits (247), Expect = 3.6e-18 Identity = 47/63 (74.60%), Postives = 53/63 (84.13%), Query Frame = 3
BLAST of MU65992 vs. NCBI nr
Match: gi|920571805|ref|WP_053003332.1| (hypothetical protein [Shigella sonnei]) HSP 1 Score: 93.6 bits (231), Expect = 2.6e-16 Identity = 44/52 (84.62%), Postives = 45/52 (86.54%), Query Frame = -3
BLAST of MU65992 vs. NCBI nr
Match: gi|391297122|gb|EIQ55189.1| (putative transposase [Shigella sonnei 4822-66]) HSP 1 Score: 90.1 bits (222), Expect = 2.9e-15 Identity = 43/50 (86.00%), Postives = 43/50 (86.00%), Query Frame = -3
BLAST of MU65992 vs. NCBI nr
Match: gi|921952926|emb|CTT74932.1| (xanthine dehydrogenase subunit XdhA [Escherichia coli]) HSP 1 Score: 89.7 bits (221), Expect = 3.8e-15 Identity = 42/47 (89.36%), Postives = 45/47 (95.74%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|