MU65878 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CAATGCCTCCCCCCTTATCGTCGTCTCTCTTCACGATGCTATTGGGAAGGTCTTGGCTCAAGACATTCGCGCTTCTGACCCTTTGCCCCCTTATCCAGCCTTCCCATTAAGGATGGCTATGCA
BLAST of MU65878 vs. Swiss-Prot
Match: CNX1_ARATH (Molybdopterin biosynthesis protein CNX1 OS=Arabidopsis thaliana GN=CNX1 PE=1 SV=2) HSP 1 Score: 52.4 bits (124), Expect = 1.4e-06 Identity = 22/30 (73.33%), Postives = 26/30 (86.67%), Query Frame = 2
BLAST of MU65878 vs. TrEMBL
Match: A0A0A0LZS5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G600220 PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 9.4e-07 Identity = 28/30 (93.33%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of MU65878 vs. TAIR10
Match: AT5G20990.1 (AT5G20990.1 molybdopterin biosynthesis CNX1 protein / molybdenum cofactor biosynthesis enzyme CNX1 (CNX1)) HSP 1 Score: 52.4 bits (124), Expect = 7.6e-08 Identity = 22/30 (73.33%), Postives = 26/30 (86.67%), Query Frame = 2
BLAST of MU65878 vs. NCBI nr
Match: gi|659100319|ref|XP_008451034.1| (PREDICTED: molybdopterin biosynthesis protein CNX1 [Cucumis melo]) HSP 1 Score: 60.8 bits (146), Expect = 6.1e-07 Identity = 29/30 (96.67%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of MU65878 vs. NCBI nr
Match: gi|700211286|gb|KGN66382.1| (hypothetical protein Csa_1G600220 [Cucumis sativus]) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-06 Identity = 28/30 (93.33%), Postives = 29/30 (96.67%), Query Frame = 2
BLAST of MU65878 vs. NCBI nr
Match: gi|778663355|ref|XP_011660066.1| (PREDICTED: molybdopterin biosynthesis protein CNX1 [Cucumis sativus]) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-06 Identity = 28/30 (93.33%), Postives = 29/30 (96.67%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|