MU65578 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ACAGAAATTTGCCGACGTAAAAAGCCACAGAACATAGGGAAGCAACTCCAGTGATGAGGAAAAGCGCCCAGAAGCTGTTGATGCTCAAGCGGGTGGAAGACAACTCTGCCACTTTTGAAGCCGT
BLAST of MU65578 vs. TrEMBL
Match: A0A0A0LML3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G383400 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 2.9e-16 Identity = 39/40 (97.50%), Postives = 40/40 (100.00%), Query Frame = -3
BLAST of MU65578 vs. NCBI nr
Match: gi|700207899|gb|KGN63018.1| (hypothetical protein Csa_2G383400 [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 8.5e-17 Identity = 39/40 (97.50%), Postives = 40/40 (100.00%), Query Frame = -3
BLAST of MU65578 vs. NCBI nr
Match: gi|659089045|ref|XP_008445299.1| (PREDICTED: glutamate receptor 2.5-like isoform X2 [Cucumis melo]) HSP 1 Score: 77.8 bits (190), Expect = 4.9e-12 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = -1
BLAST of MU65578 vs. NCBI nr
Match: gi|778674395|ref|XP_011650201.1| (PREDICTED: glutamate receptor 2.5-like [Cucumis sativus]) HSP 1 Score: 77.8 bits (190), Expect = 4.9e-12 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = -1
BLAST of MU65578 vs. NCBI nr
Match: gi|659089041|ref|XP_008445296.1| (PREDICTED: glutamate receptor 2.5-like isoform X1 [Cucumis melo]) HSP 1 Score: 77.8 bits (190), Expect = 4.9e-12 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|