MU64639 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
TTTGGAGTAACGAGGAGTGATTTTAGGAACTTGTGGTTGGTGGTTCTGCTTCGCACCGTGTTGAGATTTGTGGTTGTGGCGTTCGTTTTTCTTGTTCCCGATGCGAATCAATCGGACATTTTGATTCCGGGTGATCCTACGATGGTTAGAAAGAGTAATTCGAGGACGACGAAGGAAGATGGGGATAACATTCCTCTTGTTTCCATGAGAAGCGAGGGTCGAGATTAGTGTGTACAGAATGTAAAGCTAGAAATGTTACATGGGATTGAAATAATTGGATTATGAATTTGAGATATTTTGGATTTTTCAT
BLAST of MU64639 vs. TrEMBL
Match: A0A0A0LMJ9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G382710 PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 3.3e-11 Identity = 43/75 (57.33%), Postives = 46/75 (61.33%), Query Frame = 1
BLAST of MU64639 vs. NCBI nr
Match: gi|659088992|ref|XP_008445270.1| (PREDICTED: probable folate-biopterin transporter 6 [Cucumis melo]) HSP 1 Score: 97.1 bits (240), Expect = 2.0e-17 Identity = 51/75 (68.00%), Postives = 51/75 (68.00%), Query Frame = 1
BLAST of MU64639 vs. NCBI nr
Match: gi|700207879|gb|KGN62998.1| (hypothetical protein Csa_2G382710 [Cucumis sativus]) HSP 1 Score: 75.9 bits (185), Expect = 4.7e-11 Identity = 43/75 (57.33%), Postives = 46/75 (61.33%), Query Frame = 1
BLAST of MU64639 vs. NCBI nr
Match: gi|778672667|ref|XP_011649848.1| (PREDICTED: probable folate-biopterin transporter 6 [Cucumis sativus]) HSP 1 Score: 75.9 bits (185), Expect = 4.7e-11 Identity = 43/75 (57.33%), Postives = 46/75 (61.33%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|