MU64609 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AACTTTCTCTAATTGCCTGGGGAAAATCATTAAGCTAAATAGGGAATTACTGTTAATGCTAAACAAAATCCTCAGGCCTTTCAATTATTCTCTCTCTTATTCCAGCATTTGATGATAAAATGTGAGTATGGCTGTTGCTTGCATAGTATTGGTTTTGGCTTCATGGTATTTCCAAAAACACTAATTCTTTAACGGTAATACTAATGATATTGGAGAGCTCTTGAAATTGATTTGGAGGTAATAATTTCGACCTTTCAATTGATAATTAGGCTTTGAAAATTGAAGGCATTCCTACGTAATTTTCCTGAGCAAGGGTATGTTGACAAATTGGTATCTATGTTAACGACCTCATAGCGGTTGCATGCCAAAAATTAATATCTTCTCAGTTAAAAATCGACGTTTGAACCTGGTTAGAAGAGCTTTATTGATTTTCTGATGGACTCTGGTGATGTCGAGCAATCCTTGCTTCTTAAGTTGTTTGATTCTGATAAGAGGAATTCTCTCCTGAGAAGGAAATCTAATCGACATGGTAGTTTTTCACATTCAGTAAAAATAATAAACCACAAAATTATGATGTAGCTCATCAACGTGTTGCTGTTTCACAAATTAGTTTTAGGAAAGTATTTGTTCTTCTAGCGACTTATTTAGGAGGAGGCACATTTTGTTTTTTCCTTGTTCGGGATCAGATCACTGGAAAGAAAACAAATGGGGTTGTCGATTCCATTTACTTTTGTGTTGTGACAATGACCACCGTTGGGTATGGTGATCTTGTTCCTAATAGCATGGTTGCAAAACTACTTGCATGTGTTTAT
BLAST of MU64609 vs. Swiss-Prot
Match: KCO1_ARATH (Two-pore potassium channel 1 OS=Arabidopsis thaliana GN=TPK1 PE=1 SV=2) HSP 1 Score: 101.3 bits (251), Expect = 1.7e-20 Identity = 45/68 (66.18%), Postives = 55/68 (80.88%), Query Frame = 3
BLAST of MU64609 vs. Swiss-Prot
Match: KCO1_ORYSJ (Two pore potassium channel a OS=Oryza sativa subsp. japonica GN=TPKA PE=1 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 1.5e-16 Identity = 42/68 (61.76%), Postives = 50/68 (73.53%), Query Frame = 3
BLAST of MU64609 vs. Swiss-Prot
Match: KCO2_ORYSJ (Two pore potassium channel b OS=Oryza sativa subsp. japonica GN=TPKB PE=1 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 6.3e-15 Identity = 40/68 (58.82%), Postives = 47/68 (69.12%), Query Frame = 3
BLAST of MU64609 vs. Swiss-Prot
Match: KCO6_ARATH (Two-pore potassium channel 3 OS=Arabidopsis thaliana GN=TPK3 PE=2 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 1.9e-11 Identity = 31/66 (46.97%), Postives = 42/66 (63.64%), Query Frame = 3
BLAST of MU64609 vs. Swiss-Prot
Match: KCO2_ARATH (Two-pore potassium channel 2 OS=Arabidopsis thaliana GN=TPK2 PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 2.7e-10 Identity = 34/89 (38.20%), Postives = 49/89 (55.06%), Query Frame = 3
HSP 2 Score: 40.0 bits (92), Expect = 4.7e-02 Identity = 17/35 (48.57%), Postives = 24/35 (68.57%), Query Frame = 3
BLAST of MU64609 vs. TrEMBL
Match: A0A0A0LW31_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G173170 PE=4 SV=1) HSP 1 Score: 169.1 bits (427), Expect = 7.4e-39 Identity = 82/88 (93.18%), Postives = 87/88 (98.86%), Query Frame = 3
BLAST of MU64609 vs. TrEMBL
Match: A0A0A0LW31_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G173170 PE=4 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 5.2e-08 Identity = 33/39 (84.62%), Postives = 35/39 (89.74%), Query Frame = 1
HSP 2 Score: 118.6 bits (296), Expect = 1.2e-23 Identity = 57/95 (60.00%), Postives = 71/95 (74.74%), Query Frame = 3
BLAST of MU64609 vs. TrEMBL
Match: D7T5G8_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_00s0194g00250 PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 6.3e-22 Identity = 49/68 (72.06%), Postives = 63/68 (92.65%), Query Frame = 3
BLAST of MU64609 vs. TrEMBL
Match: A0A067FSZ2_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g038674mg PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 1.4e-21 Identity = 53/88 (60.23%), Postives = 67/88 (76.14%), Query Frame = 3
BLAST of MU64609 vs. TrEMBL
Match: D7T5G4_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_00s0194g00210 PE=4 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 1.4e-21 Identity = 48/68 (70.59%), Postives = 63/68 (92.65%), Query Frame = 3
BLAST of MU64609 vs. TAIR10
Match: AT5G55630.1 (AT5G55630.1 Outward rectifying potassium channel protein) HSP 1 Score: 101.3 bits (251), Expect = 9.7e-22 Identity = 45/68 (66.18%), Postives = 55/68 (80.88%), Query Frame = 3
BLAST of MU64609 vs. TAIR10
Match: AT4G18160.1 (AT4G18160.1 Ca2+ activated outward rectifying K+ channel 6) HSP 1 Score: 71.2 bits (173), Expect = 1.1e-12 Identity = 31/66 (46.97%), Postives = 42/66 (63.64%), Query Frame = 3
BLAST of MU64609 vs. TAIR10
Match: AT5G46370.1 (AT5G46370.1 Ca2+ activated outward rectifying K+ channel 2) HSP 1 Score: 67.4 bits (163), Expect = 1.5e-11 Identity = 34/89 (38.20%), Postives = 49/89 (55.06%), Query Frame = 3
HSP 2 Score: 40.0 bits (92), Expect = 2.6e-03 Identity = 17/35 (48.57%), Postives = 24/35 (68.57%), Query Frame = 3
BLAST of MU64609 vs. TAIR10
Match: AT4G01840.1 (AT4G01840.1 Ca2+ activated outward rectifying K+ channel 5) HSP 1 Score: 62.0 bits (149), Expect = 6.5e-10 Identity = 30/72 (41.67%), Postives = 42/72 (58.33%), Query Frame = 3
HSP 2 Score: 37.4 bits (85), Expect = 1.7e-02 Identity = 16/35 (45.71%), Postives = 22/35 (62.86%), Query Frame = 3
BLAST of MU64609 vs. TAIR10
Match: AT1G02510.1 (AT1G02510.1 Outward rectifying potassium channel protein) HSP 1 Score: 60.8 bits (146), Expect = 1.4e-09 Identity = 28/61 (45.90%), Postives = 37/61 (60.66%), Query Frame = 3
HSP 2 Score: 30.8 bits (68), Expect = 1.6e+00 Identity = 11/18 (61.11%), Postives = 14/18 (77.78%), Query Frame = 3
BLAST of MU64609 vs. NCBI nr
Match: gi|659128596|ref|XP_008464279.1| (PREDICTED: LOW QUALITY PROTEIN: two-pore potassium channel 1-like [Cucumis melo]) HSP 1 Score: 176.0 bits (445), Expect = 8.7e-41 Identity = 86/88 (97.73%), Postives = 87/88 (98.86%), Query Frame = 3
BLAST of MU64609 vs. NCBI nr
Match: gi|449443674|ref|XP_004139602.1| (PREDICTED: two-pore potassium channel 1-like [Cucumis sativus]) HSP 1 Score: 168.3 bits (425), Expect = 1.8e-38 Identity = 82/88 (93.18%), Postives = 87/88 (98.86%), Query Frame = 3
BLAST of MU64609 vs. NCBI nr
Match: gi|703066183|ref|XP_010087645.1| (Calcium-activated outward-rectifying potassium channel 1 [Morus notabilis]) HSP 1 Score: 118.2 bits (295), Expect = 2.2e-23 Identity = 57/95 (60.00%), Postives = 71/95 (74.74%), Query Frame = 3
BLAST of MU64609 vs. NCBI nr
Match: gi|657958877|ref|XP_008370978.1| (PREDICTED: two-pore potassium channel 1-like isoform X1 [Malus domestica]) HSP 1 Score: 111.7 bits (278), Expect = 2.0e-21 Identity = 51/70 (72.86%), Postives = 61/70 (87.14%), Query Frame = 3
BLAST of MU64609 vs. NCBI nr
Match: gi|657958881|ref|XP_008370981.1| (PREDICTED: two-pore potassium channel 1-like isoform X2 [Malus domestica]) HSP 1 Score: 111.7 bits (278), Expect = 2.0e-21 Identity = 51/70 (72.86%), Postives = 61/70 (87.14%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|