MU64469 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AAGGAAGCCATTGTTTTCATGATTGGAGGGGGTAACTATGTCGAGTACGGGAGCTTGCAAGAACTGTCAATGAATCAGCAGCCAGTCAAGCATATAATATACGGTAGCACCGAAATTCTCACCGGAGTTGAGTTTGTGGAGCAGCTTTCGCTTTTGGGGCAGAAGATGGGATTTGGCAATGTGGCTGCTCCTCCTCCTCCTCCAGGTCGTTAACTGAACCCCTTTCTGTAAAATTTCTTTGTCCACTGCAGTGCCTAGGATTGGCTAATTCATTAAAGAAATTGGTGCAAATCTGCACAAGAATATCTTGGGTTATAGAATCTACCCACCTCAGTTGTTTTCAAGGCAACTTTCATGTTCTTAAAATCAGACTCTTGATTGACCTCAACCTTCGATAATCTGGGAAGAATGCCTTCGTTGTAGATGTTAGTTTGTCCATTTAATAACTTTTTGTATTCTTTAGAGTTTTATGTATTTGGAAATTCCTTTGCCAAACATTCTTTTGTCAAAGCTTGTCCTAAATTTCTTTGTTAAATGATATCTACAAAGATTATTATATGTGTAATTGTAGGT
BLAST of MU64469 vs. Swiss-Prot
Match: SLY1_ARATH (SEC1 family transport protein SLY1 OS=Arabidopsis thaliana GN=SLY1 PE=1 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 1.6e-17 Identity = 44/59 (74.58%), Postives = 48/59 (81.36%), Query Frame = 1
BLAST of MU64469 vs. Swiss-Prot
Match: SLY1_ORYSJ (SEC1 family transport protein SLY1 OS=Oryza sativa subsp. japonica GN=SLY1 PE=2 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 2.4e-16 Identity = 41/61 (67.21%), Postives = 46/61 (75.41%), Query Frame = 1
BLAST of MU64469 vs. Swiss-Prot
Match: SCFD1_RAT (Sec1 family domain-containing protein 1 OS=Rattus norvegicus GN=Scfd1 PE=1 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 8.1e-09 Identity = 29/55 (52.73%), Postives = 39/55 (70.91%), Query Frame = 1
BLAST of MU64469 vs. Swiss-Prot
Match: SLY1_SCHPO (Protein sly1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=sly1 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 1.1e-08 Identity = 28/51 (54.90%), Postives = 38/51 (74.51%), Query Frame = 1
BLAST of MU64469 vs. Swiss-Prot
Match: SCFD1_HUMAN (Sec1 family domain-containing protein 1 OS=Homo sapiens GN=SCFD1 PE=1 SV=4) HSP 1 Score: 61.2 bits (147), Expect = 1.4e-08 Identity = 28/55 (50.91%), Postives = 39/55 (70.91%), Query Frame = 1
BLAST of MU64469 vs. TrEMBL
Match: A0A0A0KSS4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G265810 PE=3 SV=1) HSP 1 Score: 124.8 bits (312), Expect = 1.1e-25 Identity = 62/70 (88.57%), Postives = 63/70 (90.00%), Query Frame = 1
BLAST of MU64469 vs. TrEMBL
Match: A0A151RZJ2_CAJCA (SEC1 family transport protein SLY1 OS=Cajanus cajan GN=KK1_030401 PE=3 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 1.3e-21 Identity = 53/61 (86.89%), Postives = 58/61 (95.08%), Query Frame = 1
BLAST of MU64469 vs. TrEMBL
Match: F6I0W3_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_03s0038g03110 PE=3 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 2.9e-21 Identity = 52/60 (86.67%), Postives = 57/60 (95.00%), Query Frame = 1
BLAST of MU64469 vs. TrEMBL
Match: W9S8Q4_9ROSA (SEC1 family transport protein OS=Morus notabilis GN=L484_006590 PE=3 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 1.1e-20 Identity = 52/59 (88.14%), Postives = 55/59 (93.22%), Query Frame = 1
BLAST of MU64469 vs. TrEMBL
Match: A0A059BEU5_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_G01854 PE=3 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 1.1e-20 Identity = 51/61 (83.61%), Postives = 58/61 (95.08%), Query Frame = 1
BLAST of MU64469 vs. TAIR10
Match: AT2G17980.1 (AT2G17980.1 Sec1/munc18-like (SM) proteins superfamily) HSP 1 Score: 90.9 bits (224), Expect = 9.2e-19 Identity = 44/59 (74.58%), Postives = 48/59 (81.36%), Query Frame = 1
BLAST of MU64469 vs. TAIR10
Match: AT4G31740.1 (AT4G31740.1 Sec1/munc18-like (SM) proteins superfamily) HSP 1 Score: 88.2 bits (217), Expect = 6.0e-18 Identity = 43/57 (75.44%), Postives = 46/57 (80.70%), Query Frame = 1
BLAST of MU64469 vs. NCBI nr
Match: gi|659120511|ref|XP_008460227.1| (PREDICTED: SEC1 family transport protein SLY1 [Cucumis melo]) HSP 1 Score: 127.1 bits (318), Expect = 3.3e-26 Identity = 63/70 (90.00%), Postives = 63/70 (90.00%), Query Frame = 1
BLAST of MU64469 vs. NCBI nr
Match: gi|449445286|ref|XP_004140404.1| (PREDICTED: SEC1 family transport protein SLY1-like [Cucumis sativus]) HSP 1 Score: 126.7 bits (317), Expect = 4.3e-26 Identity = 62/70 (88.57%), Postives = 63/70 (90.00%), Query Frame = 1
BLAST of MU64469 vs. NCBI nr
Match: gi|1012336619|gb|KYP47914.1| (SEC1 family transport protein SLY1 [Cajanus cajan]) HSP 1 Score: 112.8 bits (281), Expect = 6.4e-22 Identity = 53/61 (86.89%), Postives = 58/61 (95.08%), Query Frame = 1
BLAST of MU64469 vs. NCBI nr
Match: gi|297744543|emb|CBI37805.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 111.7 bits (278), Expect = 1.4e-21 Identity = 52/60 (86.67%), Postives = 57/60 (95.00%), Query Frame = 1
BLAST of MU64469 vs. NCBI nr
Match: gi|225428141|ref|XP_002278576.1| (PREDICTED: SEC1 family transport protein SLY1 [Vitis vinifera]) HSP 1 Score: 111.7 bits (278), Expect = 1.4e-21 Identity = 52/60 (86.67%), Postives = 57/60 (95.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|