MU64409 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GGGCATCTTCATTTCGAAGTTGGAGCTTTCGCAACAATGGCGGAACCACATGGTGGAGGCAACCACGATCTCGAGCAGACCTTGAAGCCCTTCTTTCAAAGAGCTTCTCAAGCCGAGGATCGTTTGTCAAGATTAGAAGCTGCTCTCTTGAGTAAGAAAGATGACCATAACGAAGAACATCTCAAAACGATAAGTGAACTCCAGACAAAGCTAGACAGCGCAAACAATGCACTAATCGAAGAACGGAAAAAGGCAAGTATAATTGGTGCACCATGTTTGTGTTTCACCTCGACTAGATGGAAAGGTTCAAGCGGAGAGATTTCAAGGTTATTTGATTCTTTTGCAGGCTGAGATGGTTGCTGAAGAAAATGCTAAGCTTCAGTATCGCATAATTCATCTTGTGAGGACAGCTAGGGAAACCCATTAAAAGTTGGAGCTTGAATCACGTTTTTTTTCTAGTTAAGAGAATTGGATAGTTTAAAATTTTATACTCTTTTATAATTTCCTTTACAGACCTTTGGAAAATTGAAATTGCAAAAATGTGAATTGAATTTTTGATGTCCCC
BLAST of MU64409 vs. TrEMBL
Match: A0A067JTC8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_21121 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 9.8e-14 Identity = 47/79 (59.49%), Postives = 56/79 (70.89%), Query Frame = 1
BLAST of MU64409 vs. TrEMBL
Match: A0A067JTC8_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_21121 PE=4 SV=1) HSP 1 Score: 33.9 bits (76), Expect = 2.6e+02 Identity = 16/27 (59.26%), Postives = 19/27 (70.37%), Query Frame = 2
HSP 2 Score: 83.2 bits (204), Expect = 3.7e-13 Identity = 42/63 (66.67%), Postives = 51/63 (80.95%), Query Frame = 1
BLAST of MU64409 vs. TrEMBL
Match: A9PB69_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0006s04540g PE=2 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 2.4e+01 Identity = 18/31 (58.06%), Postives = 23/31 (74.19%), Query Frame = 2
HSP 2 Score: 83.2 bits (204), Expect = 3.7e-13 Identity = 42/63 (66.67%), Postives = 51/63 (80.95%), Query Frame = 1
BLAST of MU64409 vs. TrEMBL
Match: B9H9I5_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0006s04540g PE=4 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 2.4e+01 Identity = 18/31 (58.06%), Postives = 23/31 (74.19%), Query Frame = 2
HSP 2 Score: 82.8 bits (203), Expect = 4.9e-13 Identity = 43/68 (63.24%), Postives = 55/68 (80.88%), Query Frame = 1
BLAST of MU64409 vs. TrEMBL
Match: A0A0B2S9Y2_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_048169 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 2.1e+00 Identity = 19/31 (61.29%), Postives = 24/31 (77.42%), Query Frame = 2
HSP 2 Score: 82.8 bits (203), Expect = 4.9e-13 Identity = 43/68 (63.24%), Postives = 55/68 (80.88%), Query Frame = 1
BLAST of MU64409 vs. TAIR10
Match: AT3G57320.1 (AT3G57320.1 unknown protein) HSP 1 Score: 55.1 bits (131), Expect = 5.5e-08 Identity = 29/65 (44.62%), Postives = 43/65 (66.15%), Query Frame = 1
HSP 2 Score: 31.6 bits (70), Expect = 6.5e-01 Identity = 15/28 (53.57%), Postives = 18/28 (64.29%), Query Frame = 2
BLAST of MU64409 vs. NCBI nr
Match: gi|659129279|ref|XP_008464608.1| (PREDICTED: uncharacterized protein LOC103502450 isoform X1 [Cucumis melo]) HSP 1 Score: 207.2 bits (526), Expect = 2.5e-50 Identity = 103/104 (99.04%), Postives = 103/104 (99.04%), Query Frame = 1
BLAST of MU64409 vs. NCBI nr
Match: gi|659129281|ref|XP_008464609.1| (PREDICTED: uncharacterized protein LOC103502450 isoform X2 [Cucumis melo]) HSP 1 Score: 145.2 bits (365), Expect = 1.2e-31 Identity = 73/76 (96.05%), Postives = 75/76 (98.68%), Query Frame = 1
BLAST of MU64409 vs. NCBI nr
Match: gi|1009159888|ref|XP_015898059.1| (PREDICTED: uncharacterized protein LOC107431605 [Ziziphus jujuba]) HSP 1 Score: 87.0 bits (214), Expect = 3.7e-14 Identity = 49/78 (62.82%), Postives = 60/78 (76.92%), Query Frame = 1
BLAST of MU64409 vs. NCBI nr
Match: gi|802730501|ref|XP_012086217.1| (PREDICTED: uncharacterized protein LOC105645264 isoform X2 [Jatropha curcas]) HSP 1 Score: 81.6 bits (200), Expect = 1.6e-12 Identity = 47/79 (59.49%), Postives = 56/79 (70.89%), Query Frame = 1
BLAST of MU64409 vs. NCBI nr
Match: gi|502123244|ref|XP_004498045.1| (PREDICTED: uncharacterized protein LOC101495451 [Cicer arietinum]) HSP 1 Score: 81.3 bits (199), Expect = 2.0e-12 Identity = 42/69 (60.87%), Postives = 56/69 (81.16%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|