MU64361 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AGTTCTTATTGAGTCTTTGAATATGAAACTTATTTCACATCTGTCTAATACATATAACACTCGGTTCAATTTCTAATTAATATAGTTATTTTATTTTATTTTCTTTTAATTAGGATGCCATCAAAATTTAAAGAGGTGGAATGCGTAACTAATAAAAGTGAAACCAAATTTGAAGCTTTCGGTGGCCATTTGTTTTCTTTTCCTCTCTTTAATTATCTCTTCATTCTTGACAGTGGCCAATGATACATTACTTATTGCCTTTTTTGAGTTATGATTTCAATTTTGATTATGTTCAATTGCTTGAGAATTCTGGATTTCACATCAAGACTTGGCTATTGCATCTTCAAAATTGAAATTGTGCATAAAGAATGAAGTTTGTTATGAACTTATACTCAAGTTGTGAACTCCAATCATAAAAATGAAAAACAAAAATTATATGGATATAGATTCACACCCAAATTCATTACAAGCTACTGCCTTTTTATATGGTAGTTGTTTTATCTTCTATGACACAGGATTGGCTAGGCAACCTAAGTGGTGTCACTTGAGAGATGTTCATAAAGCTATAAAGATGTGCGAAAAAGCATTAGTGAGTACAAATCCTGTAGTTACTTCTCTTGGCCAAAAACACTTTCAAACAAGAAATACTTCTCATTGATATAATAATAAAAACGATACAAACTCT
BLAST of MU64361 vs. Swiss-Prot
Match: BGAL_ASPOF (Beta-galactosidase OS=Asparagus officinalis PE=2 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 4.4e-09 Identity = 28/37 (75.68%), Postives = 29/37 (78.38%), Query Frame = 2
BLAST of MU64361 vs. Swiss-Prot
Match: BGAL8_ARATH (Beta-galactosidase 8 OS=Arabidopsis thaliana GN=BGAL8 PE=2 SV=2) HSP 1 Score: 62.8 bits (151), Expect = 5.7e-09 Identity = 26/36 (72.22%), Postives = 30/36 (83.33%), Query Frame = 2
BLAST of MU64361 vs. Swiss-Prot
Match: BGAL3_ARATH (Beta-galactosidase 3 OS=Arabidopsis thaliana GN=BGAL3 PE=2 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 1.3e-08 Identity = 27/38 (71.05%), Postives = 32/38 (84.21%), Query Frame = 2
BLAST of MU64361 vs. Swiss-Prot
Match: BGAL6_ORYSJ (Beta-galactosidase 6 OS=Oryza sativa subsp. japonica GN=Os03g0255100 PE=1 SV=2) HSP 1 Score: 59.7 bits (143), Expect = 4.8e-08 Identity = 29/52 (55.77%), Postives = 35/52 (67.31%), Query Frame = 2
BLAST of MU64361 vs. Swiss-Prot
Match: BGAL_MALDO (Beta-galactosidase OS=Malus domestica PE=1 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 6.3e-08 Identity = 32/69 (46.38%), Postives = 42/69 (60.87%), Query Frame = 2
BLAST of MU64361 vs. TrEMBL
Match: A0A0A0LUR1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G085360 PE=3 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 1.2e-08 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 2
BLAST of MU64361 vs. TrEMBL
Match: A0A0A0LYV5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G587990 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 1.3e-07 Identity = 35/68 (51.47%), Postives = 45/68 (66.18%), Query Frame = 2
BLAST of MU64361 vs. TrEMBL
Match: W5E7D4_WHEAT (Beta-galactosidase OS=Triticum aestivum PE=3 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 1.7e-07 Identity = 29/37 (78.38%), Postives = 31/37 (83.78%), Query Frame = 2
BLAST of MU64361 vs. TrEMBL
Match: V4MAP5_EUTSA (Beta-galactosidase OS=Eutrema salsugineum GN=EUTSA_v10024387mg PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 2.2e-07 Identity = 29/38 (76.32%), Postives = 35/38 (92.11%), Query Frame = 2
BLAST of MU64361 vs. TrEMBL
Match: O04976_MANIN (Beta-galactosidase (Fragment) OS=Mangifera indica GN=SP26 PE=2 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 2.2e-07 Identity = 32/51 (62.75%), Postives = 39/51 (76.47%), Query Frame = 2
BLAST of MU64361 vs. TAIR10
Match: AT2G28470.1 (AT2G28470.1 beta-galactosidase 8) HSP 1 Score: 62.8 bits (151), Expect = 3.2e-10 Identity = 26/36 (72.22%), Postives = 30/36 (83.33%), Query Frame = 2
BLAST of MU64361 vs. TAIR10
Match: AT4G36360.1 (AT4G36360.1 beta-galactosidase 3) HSP 1 Score: 61.6 bits (148), Expect = 7.2e-10 Identity = 27/38 (71.05%), Postives = 32/38 (84.21%), Query Frame = 2
BLAST of MU64361 vs. TAIR10
Match: AT3G52840.1 (AT3G52840.1 beta-galactosidase 2) HSP 1 Score: 58.2 bits (139), Expect = 7.9e-09 Identity = 31/76 (40.79%), Postives = 47/76 (61.84%), Query Frame = 2
BLAST of MU64361 vs. TAIR10
Match: AT4G26140.1 (AT4G26140.1 beta-galactosidase 12) HSP 1 Score: 55.5 bits (132), Expect = 5.1e-08 Identity = 28/53 (52.83%), Postives = 36/53 (67.92%), Query Frame = 2
BLAST of MU64361 vs. TAIR10
Match: AT3G13750.1 (AT3G13750.1 beta galactosidase 1) HSP 1 Score: 52.8 bits (125), Expect = 3.3e-07 Identity = 27/51 (52.94%), Postives = 32/51 (62.75%), Query Frame = 2
BLAST of MU64361 vs. NCBI nr
Match: gi|449462081|ref|XP_004148770.1| (PREDICTED: beta-galactosidase 8 [Cucumis sativus]) HSP 1 Score: 70.5 bits (171), Expect = 4.4e-09 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 2
BLAST of MU64361 vs. NCBI nr
Match: gi|700209643|gb|KGN64739.1| (hypothetical protein Csa_1G085360 [Cucumis sativus]) HSP 1 Score: 70.5 bits (171), Expect = 4.4e-09 Identity = 35/51 (68.63%), Postives = 40/51 (78.43%), Query Frame = 2
BLAST of MU64361 vs. NCBI nr
Match: gi|659072190|ref|XP_008463829.1| (PREDICTED: beta-galactosidase 8 [Cucumis melo]) HSP 1 Score: 70.1 bits (170), Expect = 5.7e-09 Identity = 34/51 (66.67%), Postives = 40/51 (78.43%), Query Frame = 2
BLAST of MU64361 vs. NCBI nr
Match: gi|2209358|gb|AAB61470.1| (beta-D-galactosidase [Mangifera indica]) HSP 1 Score: 66.2 bits (160), Expect = 8.2e-08 Identity = 32/51 (62.75%), Postives = 39/51 (76.47%), Query Frame = 2
BLAST of MU64361 vs. NCBI nr
Match: gi|502082310|ref|XP_004487127.1| (PREDICTED: beta-galactosidase 8-like [Cicer arietinum]) HSP 1 Score: 66.2 bits (160), Expect = 8.2e-08 Identity = 30/52 (57.69%), Postives = 41/52 (78.85%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|