MU63201 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GTCAAGAATTAATTCACAAATATTGGTGTGGGTTCAACTCTCCTTTCCCACCCATTAACCCTTATAAATGTATACACCAGCTTTCTTTCAACAAAATATTTTTGGTTTTTATTCATTTGAAAAATAAGAAAAATGGGTGGAGGAATTATTGGTTTAGTTTTGGGTTTAATTGCTGTGGTTTTGATTCACCAAGCCACCGCTCAGACGGTTCGTGTAGTCGGAGACTCCACCGGTTGGACGGTTCCGAAGGGCGGTGCTGCTTTCTATTCCGAGTGGGCTTCTAAATTCAACTTCTCCATTGGCGACTATCTAACGTTTAACTTTGGGACGAACGTGCACAGGGTCCAAAAAGTCCCAAAA
BLAST of MU63201 vs. Swiss-Prot
Match: CPC_CUCSA (Cucumber peeling cupredoxin OS=Cucumis sativus PE=1 SV=3) HSP 1 Score: 56.6 bits (135), Expect = 2.2e-07 Identity = 25/50 (50.00%), Postives = 31/50 (62.00%), Query Frame = 1
BLAST of MU63201 vs. TrEMBL
Match: A0A0A0KA53_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G432490 PE=4 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 2.5e-23 Identity = 53/58 (91.38%), Postives = 55/58 (94.83%), Query Frame = 1
BLAST of MU63201 vs. TrEMBL
Match: A0A0A0KBU0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G432480 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 6.1e-17 Identity = 43/58 (74.14%), Postives = 49/58 (84.48%), Query Frame = 1
BLAST of MU63201 vs. TrEMBL
Match: D1MWY8_CITLA (Blue copper protein OS=Citrullus lanatus subsp. vulgaris GN=CitBC PE=2 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 2.0e-12 Identity = 38/56 (67.86%), Postives = 42/56 (75.00%), Query Frame = 1
BLAST of MU63201 vs. TrEMBL
Match: F6HXD5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_09s0002g06890 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 2.6e-12 Identity = 36/58 (62.07%), Postives = 43/58 (74.14%), Query Frame = 1
BLAST of MU63201 vs. TrEMBL
Match: F6HXD5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_09s0002g06890 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 2.6e-12 Identity = 36/58 (62.07%), Postives = 43/58 (74.14%), Query Frame = 1
HSP 2 Score: 79.7 bits (195), Expect = 2.6e-12 Identity = 36/58 (62.07%), Postives = 43/58 (74.14%), Query Frame = 1
BLAST of MU63201 vs. NCBI nr
Match: gi|778729055|ref|XP_011659524.1| (PREDICTED: cucumber peeling cupredoxin-like [Cucumis sativus]) HSP 1 Score: 116.7 bits (291), Expect = 2.8e-23 Identity = 53/58 (91.38%), Postives = 55/58 (94.83%), Query Frame = 1
BLAST of MU63201 vs. NCBI nr
Match: gi|659122398|ref|XP_008461122.1| (PREDICTED: cucumber peeling cupredoxin-like [Cucumis melo]) HSP 1 Score: 97.4 bits (241), Expect = 1.8e-17 Identity = 49/63 (77.78%), Postives = 51/63 (80.95%), Query Frame = 1
BLAST of MU63201 vs. NCBI nr
Match: gi|449436615|ref|XP_004136088.1| (PREDICTED: cucumber peeling cupredoxin-like [Cucumis sativus]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 43/58 (74.14%), Postives = 49/58 (84.48%), Query Frame = 1
BLAST of MU63201 vs. NCBI nr
Match: gi|1009111271|ref|XP_015900196.1| (PREDICTED: cucumber peeling cupredoxin-like [Ziziphus jujuba]) HSP 1 Score: 81.6 bits (200), Expect = 1.0e-12 Identity = 36/58 (62.07%), Postives = 42/58 (72.41%), Query Frame = 1
BLAST of MU63201 vs. NCBI nr
Match: gi|1009111283|ref|XP_015900271.1| (PREDICTED: cucumber peeling cupredoxin-like [Ziziphus jujuba]) HSP 1 Score: 81.6 bits (200), Expect = 1.0e-12 Identity = 36/58 (62.07%), Postives = 42/58 (72.41%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|