MU63086 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CTCTATTCTTACTCTCACTTCAAAGAAGAACAAGAGCAAAAACTAAAAACACACAACATAGAGAATCGATAATGGAGGAAATGACGTCACGACCTCAACTGAACCCTCGCAGCACGCAACCTCCTTTACCACCGCCACCGTCACGACGACCCCATAACAACCATCACCGTCCTCTCCCGCCGCCACCGTCAAGAGCTCCCTTCAATCTTCACTCCAATCCCCGTTCTCCTCCATTCCCATCCACCGCACCTAATCCCAACACTCGCAACACTCGTTATCCATCTCCACCAT
BLAST of MU63086 vs. TrEMBL
Match: A0A0A0L9B0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G209460 PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.1e-08 Identity = 35/73 (47.95%), Postives = 36/73 (49.32%), Query Frame = 3
BLAST of MU63086 vs. NCBI nr
Match: gi|659112197|ref|XP_008456109.1| (PREDICTED: proline-rich receptor-like protein kinase PERK10 [Cucumis melo]) HSP 1 Score: 68.6 bits (166), Expect = 7.0e-09 Identity = 39/73 (53.42%), Postives = 39/73 (53.42%), Query Frame = 3
BLAST of MU63086 vs. NCBI nr
Match: gi|449446081|ref|XP_004140800.1| (PREDICTED: proline-rich receptor-like protein kinase PERK10 [Cucumis sativus]) HSP 1 Score: 59.7 bits (143), Expect = 3.2e-06 Identity = 35/73 (47.95%), Postives = 36/73 (49.32%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|