MU62434 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AATTTTTCTATGAAACGGTTTTCAGAACAGTGAAACAACGAAGAAAAATTCTTAATCAAACCCTTTGACAGCAAAACTTGATATATGTAACCTCTAGGCAGAATCCTCTTCTTCAAACTAAGTGCAATTAAAACTGGTCTTCTAGCAACCAAAAATGATTCACATCCAATTTTGTTGACAAAAAAATCCATTACATCATTGATCTTATCCTCAGAAG
BLAST of MU62434 vs. TrEMBL
Match: A5C3X7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_017394 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.2e-14 Identity = 47/74 (63.51%), Postives = 57/74 (77.03%), Query Frame = -3
BLAST of MU62434 vs. TrEMBL
Match: F6HDG3_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_05s0020g01640 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.7e-14 Identity = 47/74 (63.51%), Postives = 56/74 (75.68%), Query Frame = -3
BLAST of MU62434 vs. TrEMBL
Match: A5C3Y0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_017397 PE=4 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 7.0e-13 Identity = 46/74 (62.16%), Postives = 57/74 (77.03%), Query Frame = -3
BLAST of MU62434 vs. TrEMBL
Match: B9RG72_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1451940 PE=4 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.0e-12 Identity = 40/74 (54.05%), Postives = 55/74 (74.32%), Query Frame = -3
BLAST of MU62434 vs. TrEMBL
Match: A5B1K5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_003242 PE=4 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 2.7e-12 Identity = 45/74 (60.81%), Postives = 52/74 (70.27%), Query Frame = -3
BLAST of MU62434 vs. TAIR10
Match: AT1G21150.1 (AT1G21150.1 Mitochondrial transcription termination factor family protein) HSP 1 Score: 57.0 bits (136), Expect = 5.5e-09 Identity = 27/75 (36.00%), Postives = 47/75 (62.67%), Query Frame = -3
BLAST of MU62434 vs. TAIR10
Match: AT5G07900.1 (AT5G07900.1 Mitochondrial transcription termination factor family protein) HSP 1 Score: 54.7 bits (130), Expect = 2.7e-08 Identity = 31/74 (41.89%), Postives = 46/74 (62.16%), Query Frame = -3
BLAST of MU62434 vs. TAIR10
Match: AT5G64950.1 (AT5G64950.1 Mitochondrial transcription termination factor family protein) HSP 1 Score: 53.1 bits (126), Expect = 7.9e-08 Identity = 26/78 (33.33%), Postives = 45/78 (57.69%), Query Frame = -3
BLAST of MU62434 vs. NCBI nr
Match: gi|659076757|ref|XP_008438852.1| (PREDICTED: uncharacterized protein LOC103483822 isoform X3 [Cucumis melo]) HSP 1 Score: 142.9 bits (359), Expect = 2.2e-31 Identity = 71/71 (100.00%), Postives = 71/71 (100.00%), Query Frame = -3
BLAST of MU62434 vs. NCBI nr
Match: gi|778678867|ref|XP_011651053.1| (PREDICTED: uncharacterized protein LOC101209993 [Cucumis sativus]) HSP 1 Score: 113.6 bits (283), Expect = 1.4e-22 Identity = 56/74 (75.68%), Postives = 65/74 (87.84%), Query Frame = -3
BLAST of MU62434 vs. NCBI nr
Match: gi|659077783|ref|XP_008439383.1| (PREDICTED: uncharacterized protein LOC103484198 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 1.7e-20 Identity = 56/74 (75.68%), Postives = 59/74 (79.73%), Query Frame = -3
BLAST of MU62434 vs. NCBI nr
Match: gi|659076763|ref|XP_008438854.1| (PREDICTED: uncharacterized protein LOC103483826 [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 1.7e-20 Identity = 55/74 (74.32%), Postives = 60/74 (81.08%), Query Frame = -3
BLAST of MU62434 vs. NCBI nr
Match: gi|659076740|ref|XP_008438843.1| (PREDICTED: uncharacterized protein LOC103483819 isoform X6 [Cucumis melo]) HSP 1 Score: 104.8 bits (260), Expect = 6.5e-20 Identity = 54/74 (72.97%), Postives = 59/74 (79.73%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|