MU62126 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GGCATTATAATCAAGATCTTGTAATTCTAGATTTAGCGTTACCATAACACAAAATTTTAGAAAGGAGTAAGTATTGACAAGAACCAAATGCAATCATGCATATTTTCCTTGAGTTTCAAAATTAGAAGACAGATCCCCAAGCTTGAAACACATGGGTCAGAGTTTTACATTATGATGACAAGTTCAAATGCTTTCTATCATATTTTGGAATTCAACAAAATCATGATCAAATATTGTTGTTGACCAGAGCCATTATTCTCCCTCATCTTACGACGAACGTTAGGGTTTTTTCTTCCTACAAGAGAGTTTTGATGCTCTTTGCAACAATCCTCATAATTTGCTTCTCAATAGCTGGATAAAGAGCGTACCTGAATTTGCTATCTTCACACATTGGTGCACCAATCTATCATTCTCCGGTTCCATCATGTGATGGACTCTTTTATCATGTTACATCGACCAGCAATTCTCCGAAAATCATCCAGATTTAACCTCCCATCTCCATCCTTGTCAAAGCAATCAATCATATCCCTTAATTCCAT
BLAST of MU62126 vs. TrEMBL
Match: A0A0A0KDV1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G108450 PE=4 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 1.1e-11 Identity = 35/38 (92.11%), Postives = 37/38 (97.37%), Query Frame = -1
BLAST of MU62126 vs. TrEMBL
Match: B9MUX0_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0014s05960g PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 8.5e-07 Identity = 27/35 (77.14%), Postives = 31/35 (88.57%), Query Frame = -1
BLAST of MU62126 vs. TrEMBL
Match: V7ARA2_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_010G072500g PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 4.2e-06 Identity = 27/35 (77.14%), Postives = 30/35 (85.71%), Query Frame = -1
BLAST of MU62126 vs. TrEMBL
Match: A0A068UMG6_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00028889001 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 9.4e-06 Identity = 25/35 (71.43%), Postives = 31/35 (88.57%), Query Frame = -1
BLAST of MU62126 vs. TrEMBL
Match: A0A0D2QP81_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G089100 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 9.4e-06 Identity = 24/35 (68.57%), Postives = 29/35 (82.86%), Query Frame = -1
BLAST of MU62126 vs. TAIR10
Match: AT1G73440.1 (AT1G73440.1 calmodulin-related) HSP 1 Score: 52.0 bits (123), Expect = 4.5e-07 Identity = 22/35 (62.86%), Postives = 26/35 (74.29%), Query Frame = -1
BLAST of MU62126 vs. NCBI nr
Match: gi|659120420|ref|XP_008460184.1| (PREDICTED: uncharacterized protein LOC103499070 [Cucumis melo]) HSP 1 Score: 80.5 bits (197), Expect = 3.3e-12 Identity = 36/38 (94.74%), Postives = 37/38 (97.37%), Query Frame = -1
BLAST of MU62126 vs. NCBI nr
Match: gi|449445469|ref|XP_004140495.1| (PREDICTED: uncharacterized protein LOC101206207 [Cucumis sativus]) HSP 1 Score: 79.3 bits (194), Expect = 7.4e-12 Identity = 35/38 (92.11%), Postives = 37/38 (97.37%), Query Frame = -1
BLAST of MU62126 vs. NCBI nr
Match: gi|566202845|ref|XP_006375290.1| (hypothetical protein POPTR_0014s05960g [Populus trichocarpa]) HSP 1 Score: 62.8 bits (151), Expect = 7.2e-07 Identity = 27/35 (77.14%), Postives = 31/35 (88.57%), Query Frame = -1
BLAST of MU62126 vs. NCBI nr
Match: gi|593265138|ref|XP_007134747.1| (hypothetical protein PHAVU_010G072500g [Phaseolus vulgaris]) HSP 1 Score: 60.5 bits (145), Expect = 3.5e-06 Identity = 27/35 (77.14%), Postives = 30/35 (85.71%), Query Frame = -1
BLAST of MU62126 vs. NCBI nr
Match: gi|1021486193|ref|XP_016186095.1| (PREDICTED: nucleolin [Arachis ipaensis]) HSP 1 Score: 60.1 bits (144), Expect = 4.6e-06 Identity = 26/35 (74.29%), Postives = 30/35 (85.71%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|